ID: 970001842

View in Genome Browser
Species Human (GRCh38)
Location 4:11372611-11372633
Sequence AGCGCCTTCTCAGCTTCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970001842_970001844 -8 Left 970001842 4:11372611-11372633 CCAGATGAAGCTGAGAAGGCGCT 0: 1
1: 1
2: 0
3: 4
4: 99
Right 970001844 4:11372626-11372648 AAGGCGCTGAAGCACATGGATGG No data
970001842_970001845 -5 Left 970001842 4:11372611-11372633 CCAGATGAAGCTGAGAAGGCGCT 0: 1
1: 1
2: 0
3: 4
4: 99
Right 970001845 4:11372629-11372651 GCGCTGAAGCACATGGATGGAGG No data
970001842_970001846 7 Left 970001842 4:11372611-11372633 CCAGATGAAGCTGAGAAGGCGCT 0: 1
1: 1
2: 0
3: 4
4: 99
Right 970001846 4:11372641-11372663 ATGGATGGAGGACAAATTGATGG 0: 1
1: 1
2: 3
3: 64
4: 488
970001842_970001847 12 Left 970001842 4:11372611-11372633 CCAGATGAAGCTGAGAAGGCGCT 0: 1
1: 1
2: 0
3: 4
4: 99
Right 970001847 4:11372646-11372668 TGGAGGACAAATTGATGGCCAGG 0: 1
1: 0
2: 0
3: 21
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970001842 Original CRISPR AGCGCCTTCTCAGCTTCATC TGG (reversed) Intergenic