ID: 970003235

View in Genome Browser
Species Human (GRCh38)
Location 4:11385499-11385521
Sequence CAAGGCATATAGGTGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970003235_970003245 20 Left 970003235 4:11385499-11385521 CCCACCCTCACCTATATGCCTTG No data
Right 970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG No data
970003235_970003243 -5 Left 970003235 4:11385499-11385521 CCCACCCTCACCTATATGCCTTG No data
Right 970003243 4:11385517-11385539 CCTTGTTCAATGGGATGACACGG No data
970003235_970003244 3 Left 970003235 4:11385499-11385521 CCCACCCTCACCTATATGCCTTG No data
Right 970003244 4:11385525-11385547 AATGGGATGACACGGCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970003235 Original CRISPR CAAGGCATATAGGTGAGGGT GGG (reversed) Intergenic
No off target data available for this crispr