ID: 970003237

View in Genome Browser
Species Human (GRCh38)
Location 4:11385503-11385525
Sequence TGAACAAGGCATATAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970003237_970003243 -9 Left 970003237 4:11385503-11385525 CCCTCACCTATATGCCTTGTTCA No data
Right 970003243 4:11385517-11385539 CCTTGTTCAATGGGATGACACGG No data
970003237_970003245 16 Left 970003237 4:11385503-11385525 CCCTCACCTATATGCCTTGTTCA No data
Right 970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG No data
970003237_970003244 -1 Left 970003237 4:11385503-11385525 CCCTCACCTATATGCCTTGTTCA No data
Right 970003244 4:11385525-11385547 AATGGGATGACACGGCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970003237 Original CRISPR TGAACAAGGCATATAGGTGA GGG (reversed) Intergenic
No off target data available for this crispr