ID: 970003241

View in Genome Browser
Species Human (GRCh38)
Location 4:11385509-11385531
Sequence TCCCATTGAACAAGGCATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970003241_970003245 10 Left 970003241 4:11385509-11385531 CCTATATGCCTTGTTCAATGGGA No data
Right 970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG No data
970003241_970003244 -7 Left 970003241 4:11385509-11385531 CCTATATGCCTTGTTCAATGGGA No data
Right 970003244 4:11385525-11385547 AATGGGATGACACGGCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970003241 Original CRISPR TCCCATTGAACAAGGCATAT AGG (reversed) Intergenic
No off target data available for this crispr