ID: 970003242

View in Genome Browser
Species Human (GRCh38)
Location 4:11385517-11385539
Sequence CCGTGTCATCCCATTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970003242_970003245 2 Left 970003242 4:11385517-11385539 CCTTGTTCAATGGGATGACACGG No data
Right 970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970003242 Original CRISPR CCGTGTCATCCCATTGAACA AGG (reversed) Intergenic
No off target data available for this crispr