ID: 970003245

View in Genome Browser
Species Human (GRCh38)
Location 4:11385542-11385564
Sequence CTAAGGTTCTCAAATACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970003237_970003245 16 Left 970003237 4:11385503-11385525 CCCTCACCTATATGCCTTGTTCA No data
Right 970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG No data
970003238_970003245 15 Left 970003238 4:11385504-11385526 CCTCACCTATATGCCTTGTTCAA No data
Right 970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG No data
970003241_970003245 10 Left 970003241 4:11385509-11385531 CCTATATGCCTTGTTCAATGGGA No data
Right 970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG No data
970003242_970003245 2 Left 970003242 4:11385517-11385539 CCTTGTTCAATGGGATGACACGG No data
Right 970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG No data
970003235_970003245 20 Left 970003235 4:11385499-11385521 CCCACCCTCACCTATATGCCTTG No data
Right 970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG No data
970003236_970003245 19 Left 970003236 4:11385500-11385522 CCACCCTCACCTATATGCCTTGT No data
Right 970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970003245 Original CRISPR CTAAGGTTCTCAAATACTCC TGG Intergenic
No off target data available for this crispr