ID: 970003922

View in Genome Browser
Species Human (GRCh38)
Location 4:11392703-11392725
Sequence TACCTTGGAGAACTATTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970003920_970003922 -1 Left 970003920 4:11392681-11392703 CCAGTTTGGAGATATAATGGGTT No data
Right 970003922 4:11392703-11392725 TACCTTGGAGAACTATTCATTGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970003922 Original CRISPR TACCTTGGAGAACTATTCAT TGG Intergenic
905329937 1:37187461-37187483 TACCCTGGAGAACTGGTCATGGG - Intergenic
909903838 1:81172774-81172796 TGCCTTGGAGAATTTTTCTTGGG + Intergenic
910792277 1:91063874-91063896 TCCCTTGGAAAATTATTTATAGG - Intergenic
912617954 1:111124939-111124961 GACCTTTGTGAACTCTTCATTGG - Intronic
918635657 1:186771264-186771286 TACCTTAGAGAAATATTGTTAGG + Intergenic
919549260 1:198964299-198964321 TATCTTGGAGAAATTTCCATGGG + Intergenic
921742824 1:218706119-218706141 TATCTTGGAGAACTCATGATAGG + Intergenic
923596715 1:235365916-235365938 TTCCTTTGAGGCCTATTCATGGG + Intergenic
924870886 1:248043454-248043476 ATACTTGGAGAAATATTCATGGG + Intronic
1063206976 10:3841859-3841881 TACCATGGAATACTTTTCATTGG - Intergenic
1066657452 10:37709519-37709541 TACCTTGGAGTATTATTTGTGGG + Intergenic
1067041933 10:42959141-42959163 TACCTTGGAGTATTATTTGTGGG + Intergenic
1069817506 10:71207743-71207765 CACTTTTGAGAATTATTCATTGG - Intergenic
1071156510 10:82695742-82695764 TACCTTAGAGAACTTGTCAATGG - Intronic
1071377702 10:85025849-85025871 TACCTTGGAACTCTATCCATAGG - Intergenic
1073542531 10:104325290-104325312 TACCTTGAGGAACGCTTCATGGG - Intronic
1074135876 10:110625944-110625966 TTCCTTGCTGAACAATTCATGGG - Intergenic
1078813001 11:14789576-14789598 TACCTTTGGATACTATTCATTGG - Intronic
1079564163 11:21860669-21860691 TAACTTGGAGACATATTGATGGG - Intergenic
1081027058 11:38028544-38028566 TACCTAGGAGAATCATTCACCGG + Intergenic
1086844634 11:91733360-91733382 TATCTTGGAGAATTTTCCATGGG - Intergenic
1086982871 11:93217953-93217975 TCCCTTGGAGAACCATTGAAAGG + Intergenic
1087389364 11:97514435-97514457 GCCCTTAGAGAACTATTGATGGG - Intergenic
1094132902 12:27094152-27094174 CACCTTGCAGATCTCTTCATGGG + Intergenic
1098924235 12:76331593-76331615 TACCTTGCAGAGCTATTTTTGGG - Intergenic
1100023016 12:90094460-90094482 TACCTTGGAAGAATATTCTTGGG - Intergenic
1100163625 12:91891723-91891745 CACCTTGGACAACAATTCTTGGG - Intergenic
1105332740 13:19433154-19433176 TACCTTGAAGAAAGATTCAGGGG - Intronic
1105878948 13:24586625-24586647 TACCTTGAAGAAAGATTCAGGGG + Intergenic
1105920890 13:24962425-24962447 TACCTTGAAGAAAGATTCAGGGG - Intergenic
1107847266 13:44528993-44529015 TACCTGGTAGAACTCTACATGGG - Intronic
1109861418 13:68203519-68203541 AAACTGGGAGAATTATTCATTGG - Intergenic
1110005640 13:70263663-70263685 TACCTTGAATAATTTTTCATTGG - Intergenic
1112715545 13:102180763-102180785 TACCCTGGAGAAATATACACAGG + Intronic
1116056460 14:39870357-39870379 TACCTTGCAAAACTATCCTTAGG - Intergenic
1117233075 14:53742071-53742093 TTACTTGGAGATTTATTCATTGG + Intergenic
1120321449 14:82966850-82966872 TACCTTGGAGAACAATTTTGAGG + Intergenic
1122390361 14:101376906-101376928 TTCCTTTGAGAAGGATTCATAGG - Intergenic
1126862374 15:52898341-52898363 CACCGTGGAGAACAATTCAGAGG - Intergenic
1135058167 16:19248350-19248372 TACCTAGGAGTATAATTCATGGG - Intronic
1138632938 16:58313533-58313555 GCCCTTGGAGAAATGTTCATTGG + Intronic
1140708642 16:77655778-77655800 CACCTTGGAGACATATTCTTGGG - Intergenic
1153470579 18:5439927-5439949 TACATTGCTAAACTATTCATTGG - Intronic
1166607092 19:44153213-44153235 CACCTTGGGAAAATATTCATAGG - Intronic
1167857453 19:52254142-52254164 TCACTTGAAGAACTATCCATTGG + Intergenic
929394349 2:41505335-41505357 TACCTTGGAGAAAGCTTTATTGG - Intergenic
936433556 2:112483761-112483783 TACCTGGGACAACTTTTCATTGG + Intronic
944123240 2:196264490-196264512 TACTTTGGAGAAATATCCAGTGG + Intronic
946827882 2:223697425-223697447 TACCTTTTAGAACTATTCTTAGG + Intergenic
947342890 2:229158544-229158566 TACCTTCCACAAATATTCATTGG - Intronic
1169606726 20:7329990-7330012 TACCATGGGTAAGTATTCATAGG - Intergenic
1175352547 20:58335336-58335358 AACCTTGGAGAATTTTTAATTGG - Intronic
1176740283 21:10595388-10595410 TACCTTGAAGAAAGATTCAGGGG + Intronic
1178770601 21:35500243-35500265 TCCAATGGAGCACTATTCATTGG - Intronic
1179424414 21:41263080-41263102 TACCATGGAGCATTATGCATAGG + Intronic
1182010372 22:26995715-26995737 TACCTTAGAGGATTAATCATGGG + Intergenic
1183133621 22:35865022-35865044 TACTCTGCAGAAGTATTCATGGG + Intronic
952212509 3:31242428-31242450 AACCATGGAGAAGTTTTCATTGG - Intergenic
954590472 3:51777950-51777972 TTCCTTGGAGAACCAGGCATGGG - Intergenic
957577350 3:82026538-82026560 TTCCTTGAAGAAACATTCATAGG + Intergenic
959212970 3:103412376-103412398 TACATAGCAGAACTTTTCATAGG + Intergenic
959757198 3:109912919-109912941 TATCTTGGAGAATGATCCATGGG + Intergenic
961586263 3:127928664-127928686 TGCCTTGGAGCACTCTTCTTAGG + Intronic
963881261 3:150531654-150531676 TACCTAGGGGAACAATTCTTGGG - Intergenic
967709593 3:192689836-192689858 TATCTTGGTGAACTCTTCTTTGG - Intronic
968544048 4:1186907-1186929 AACCCTGGAGAACTATTGATGGG + Intronic
970003922 4:11392703-11392725 TACCTTGGAGAACTATTCATTGG + Intergenic
972671583 4:41217130-41217152 TTCCTTGGAAAACAATTAATGGG - Intergenic
973207776 4:47579691-47579713 AACCCTGGAGAACTATTGAGTGG + Intronic
974806204 4:66883438-66883460 TACTTTGGAGAACTATTGGGAGG + Intergenic
975623456 4:76317720-76317742 TACCTTGGAGAATGTTCCATGGG - Intronic
975800039 4:78051441-78051463 TACCTTAGAAATCTATTTATTGG - Intergenic
976328056 4:83795445-83795467 TCCCAGGGAGAACTATTCAGGGG + Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
983683737 4:170382888-170382910 TATCTTTGAGAATGATTCATGGG + Intergenic
984542327 4:181055263-181055285 TACCTTCAAGAACTAATCTTTGG - Intergenic
995736517 5:115306478-115306500 AACCTTGCAGAAATATTGATAGG - Intergenic
996795955 5:127347673-127347695 TTCCTTGGAAAACTATACATTGG - Intronic
1001335925 5:170796620-170796642 TACCTAGTAGAACTGTTCAAAGG + Intronic
1003635948 6:7831779-7831801 CATCTTGGAGAACTGTTCCTGGG + Intronic
1008333987 6:50277720-50277742 GACCTTGAAGAACTATTAAGAGG - Intergenic
1009028453 6:58027935-58027957 TTGCTTGGAAAATTATTCATGGG - Intergenic
1009550066 6:65079458-65079480 TAATTTGGATAACTTTTCATTGG - Intronic
1013010657 6:106117030-106117052 TACATTGGTTAACTATGCATGGG - Intergenic
1016109048 6:140198495-140198517 TACCTAGGAGAAAAATTCCTAGG - Intergenic
1020577584 7:9953969-9953991 TATCTTGGGGAACTCTTCTTTGG + Intergenic
1020633198 7:10665396-10665418 TAACTTGTAAAACTATTCATGGG + Intergenic
1024514132 7:50229772-50229794 TGCTTTGGAGAACTATCCAGAGG + Intergenic
1027810484 7:82890683-82890705 TATCTTTGAGAACTATCAATAGG + Intronic
1031539886 7:122981836-122981858 TACCTGGATGAACTATTTATAGG + Intergenic
1033979070 7:147141296-147141318 TACCTTGAAAAACTAATCAAGGG + Intronic
1037153594 8:15672008-15672030 TTCCATGGAGAACCATTTATGGG + Intronic
1051140583 9:13974868-13974890 TAACTTGGAAAAGGATTCATAGG - Intergenic
1051477476 9:17523535-17523557 CACCTTGAAGAAATATACATGGG - Intergenic
1052007706 9:23369011-23369033 TACCTTGGGGAATTCCTCATAGG - Intergenic
1052608800 9:30741875-30741897 TATTTTGGAGAATTTTTCATAGG + Intergenic
1053263031 9:36687337-36687359 GACATTGGACAACCATTCATGGG + Intergenic
1055021788 9:71677996-71678018 CACCCTGGAGAACTAGTCACTGG - Intergenic
1057072728 9:92114305-92114327 TGTCTTGCAGAGCTATTCATTGG - Intronic
1058757748 9:108099660-108099682 TACCTTGAAAAACCATTCAATGG + Intergenic
1188413778 X:29906410-29906432 TTCATTGGAAAACTACTCATTGG - Intronic
1190397181 X:49997150-49997172 TATCTCAGAGAACTTTTCATAGG + Intronic
1192024393 X:67433347-67433369 TACCTTATAGAACTATTTAGAGG + Intergenic
1193384069 X:80850284-80850306 GACCTTTGAGAAATGTTCATTGG - Intergenic
1195546207 X:106115140-106115162 AACTTTGGAGAAATATTAATGGG + Intergenic
1196257942 X:113544805-113544827 CACCTTTGAGAAGTATTAATTGG - Intergenic
1196540950 X:116907430-116907452 TACATTCAAGAACTATTGATAGG + Intergenic
1198018657 X:132636684-132636706 TACCTGAGAGAACTATTTCTGGG + Intronic