ID: 970005244

View in Genome Browser
Species Human (GRCh38)
Location 4:11404665-11404687
Sequence TTACCTGGTTTGTTTCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 267}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970005244_970005251 26 Left 970005244 4:11404665-11404687 CCCTCAAGAAACAAACCAGGTAA 0: 1
1: 0
2: 1
3: 25
4: 267
Right 970005251 4:11404714-11404736 GTTGAAGCACTTGGCTGATGTGG 0: 1
1: 0
2: 0
3: 5
4: 104
970005244_970005248 -8 Left 970005244 4:11404665-11404687 CCCTCAAGAAACAAACCAGGTAA 0: 1
1: 0
2: 1
3: 25
4: 267
Right 970005248 4:11404680-11404702 CCAGGTAAAAGTAAACAAATGGG 0: 1
1: 0
2: 1
3: 36
4: 466
970005244_970005250 17 Left 970005244 4:11404665-11404687 CCCTCAAGAAACAAACCAGGTAA 0: 1
1: 0
2: 1
3: 25
4: 267
Right 970005250 4:11404705-11404727 CTTTTGACAGTTGAAGCACTTGG No data
970005244_970005252 27 Left 970005244 4:11404665-11404687 CCCTCAAGAAACAAACCAGGTAA 0: 1
1: 0
2: 1
3: 25
4: 267
Right 970005252 4:11404715-11404737 TTGAAGCACTTGGCTGATGTGGG 0: 1
1: 0
2: 1
3: 2
4: 129
970005244_970005246 -9 Left 970005244 4:11404665-11404687 CCCTCAAGAAACAAACCAGGTAA 0: 1
1: 0
2: 1
3: 25
4: 267
Right 970005246 4:11404679-11404701 ACCAGGTAAAAGTAAACAAATGG 0: 1
1: 0
2: 1
3: 39
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970005244 Original CRISPR TTACCTGGTTTGTTTCTTGA GGG (reversed) Intronic
904153142 1:28459769-28459791 TTCCCAGGTTTGTATTTTGATGG + Intronic
905204354 1:36334533-36334555 TTATCTGTTATGTTTCTTGGCGG - Intergenic
908983747 1:69991233-69991255 TTTCCTAGTTTCTTTCTTAAAGG - Intronic
910225371 1:84930823-84930845 TTAACTGATTTGTGGCTTGAAGG - Intronic
912026240 1:105177856-105177878 TTATCTGTTCTTTTTCTTGATGG - Intergenic
912864066 1:113241188-113241210 TTCCCTGGTTTTTTTTTTTAGGG + Intergenic
914098613 1:144565151-144565173 TTTCCTGGTTTGGATCTTGCTGG - Intergenic
914300371 1:146372489-146372511 TTTCCTGGTTTGGATCTTGCTGG + Intergenic
914578666 1:149000099-149000121 TTATCTGGTGTGTTTCTGGGAGG - Intronic
915393559 1:155564590-155564612 TTACTTGTTTCGTTTCTTTAAGG + Intergenic
916102819 1:161407217-161407239 ATACCTAGTTTGTTTGTTGGGGG + Intergenic
916272413 1:162957636-162957658 TAACCTGGTTTGCTCCCTGAAGG + Intergenic
918517270 1:185376755-185376777 TTATCTGCTTTGTTTATTAACGG + Intergenic
919106666 1:193161116-193161138 TTTCCAGGTCTTTTTCTTGATGG + Intronic
919158853 1:193802686-193802708 TTACCATCTTTGTTTCTTGATGG + Intergenic
920046449 1:203135965-203135987 TTGCCTGGTCTCTTTCCTGAAGG + Intronic
921971620 1:221155205-221155227 CTATCTGCTTTGGTTCTTGAGGG + Intergenic
924651497 1:245932147-245932169 TGACCTGGTTTTTTTGTTGGTGG - Intronic
1063231356 10:4068635-4068657 TTACCTGCATTATTTCTTCATGG + Intergenic
1066397920 10:35044469-35044491 TTTCTTGTTTTGTTTCTTGGTGG - Intronic
1067256392 10:44647139-44647161 TTACCTTGTTTGTTTAATGGTGG + Intergenic
1067401816 10:45982466-45982488 TTACAAGATTTGTGTCTTGAGGG + Intronic
1067522621 10:47019631-47019653 GGAGCTGGTTTGATTCTTGAGGG + Intergenic
1067870166 10:49952069-49952091 TTACAAGATTTGTGTCTTGAGGG + Intronic
1070620300 10:78004494-78004516 TGTCCTTGTTTGTTTCCTGAGGG - Intronic
1073107540 10:101040926-101040948 TAACCTCTTTTCTTTCTTGAGGG + Exonic
1074485470 10:113873185-113873207 TAACCTTGATTGATTCTTGAAGG - Intronic
1074672117 10:115803300-115803322 TTAAGTGGTTTTTTTCCTGAAGG + Intronic
1074807654 10:117069553-117069575 TTATCTGGTTTGAATCCTGAAGG - Intronic
1074942565 10:118249317-118249339 TTTCCTTGTCTCTTTCTTGAGGG - Intergenic
1074963321 10:118467218-118467240 TTATTTGATTTGTTTCTTCAGGG - Intergenic
1078286291 11:9958971-9958993 TTGCTTGCTTAGTTTCTTGATGG + Intronic
1079318036 11:19426417-19426439 ATCCCTGGTTTATTTCTTCATGG - Intronic
1081410226 11:42749041-42749063 TTCCCTGTTTTATTACTTGAAGG - Intergenic
1081821814 11:46004899-46004921 TTCCCTGTGTTTTTTCTTGAGGG - Intronic
1083138415 11:60701455-60701477 TAACCTGCTTTGTTTCCTGTTGG - Intronic
1083895413 11:65617431-65617453 TTGCCTTGTTTGTTCCTTCATGG + Intronic
1087727809 11:101742033-101742055 TTACCTGTTTGGTTTCAGGAAGG - Intronic
1087903289 11:103666713-103666735 TTACCTGAATAGTTCCTTGAGGG - Intergenic
1088109203 11:106242561-106242583 TTTCCTGGTTGGTATCTAGATGG + Intergenic
1089728143 11:120500970-120500992 TTAGCTGGTTTGTTTGTTTTCGG + Intergenic
1091016941 11:132059776-132059798 GAGCCTGGTTTGTTTCTTCAGGG + Intronic
1092595126 12:9994584-9994606 TTGCCTGGATTGTTTGTAGAAGG + Intronic
1094351961 12:29536758-29536780 TGGCCTGGTTTGTTCCTGGAAGG - Intronic
1095459942 12:42432927-42432949 TTAGCTGTGTTGTTTCTGGATGG + Intronic
1099335629 12:81353115-81353137 TTACCTGATTTCTTTGTTGATGG + Exonic
1100129311 12:91470986-91471008 TTTACTGGTTTGTTTCTTTCTGG - Intergenic
1100407213 12:94282114-94282136 TTACTTTGTTTGTTTGTTTAGGG - Intronic
1100908047 12:99323931-99323953 TTATCTCATTTGTTTTTTGAGGG + Intronic
1101198062 12:102405984-102406006 TTCCCTGGTCTGTTTCTTCTGGG + Intronic
1101330539 12:103754266-103754288 TTACCTGGAATGTTTGTGGAAGG + Intronic
1102507455 12:113392668-113392690 GTACCTGGTGTGTTACTTGTGGG + Exonic
1103479970 12:121244597-121244619 TTCCCTGGTTGGTTTTTTGCTGG + Exonic
1103854447 12:123956313-123956335 TTTTCTGTTTTGTTTTTTGATGG + Intronic
1104617960 12:130286027-130286049 ATACCTGGTTTCTTTCTGGCTGG + Intergenic
1106693325 13:32143763-32143785 TTCCCTTGTTTGCTGCTTGATGG + Intronic
1107627213 13:42301261-42301283 TTACCTGGATTGTGTTCTGAAGG - Exonic
1107678462 13:42820953-42820975 TTACCCAGTTTGTTTATTCATGG + Intergenic
1108213652 13:48162306-48162328 GTTCCTTGTTTATTTCTTGATGG - Intergenic
1108888485 13:55222161-55222183 TTACCTTGTTTGTGTTTTGTGGG - Intergenic
1108991532 13:56663901-56663923 CTACCTGGTAAGTTTCTTGGAGG + Intergenic
1109168674 13:59068145-59068167 TTACTTGGATGTTTTCTTGATGG + Intergenic
1109421840 13:62123106-62123128 TTCACTGATTTGTTTTTTGAAGG + Intergenic
1110987531 13:81989785-81989807 TTACCTGGGTTTTTTAGTGAAGG + Intergenic
1111111335 13:83714223-83714245 TTTCTTGGGTTGTTCCTTGAAGG - Intergenic
1111276549 13:85955354-85955376 TTACCTGGTTAATGTGTTGAAGG - Intergenic
1111305453 13:86407165-86407187 ATACGTAGTTTGTTCCTTGAGGG - Intergenic
1114526316 14:23368828-23368850 CTACATGATATGTTTCTTGAGGG - Intergenic
1114916215 14:27269249-27269271 GTTCCTGCTTTGCTTCTTGATGG + Intergenic
1115016286 14:28618755-28618777 TTAACTGGTTTTCTTCTTGAAGG + Intergenic
1115120927 14:29936632-29936654 TAAATTGTTTTGTTTCTTGAGGG - Intronic
1115468009 14:33737367-33737389 TTACGTCTTTTGTTTCTGGAAGG - Intronic
1116494002 14:45538427-45538449 TGATCTGGTTTTGTTCTTGACGG - Intergenic
1116783161 14:49258782-49258804 TTATTTTGTTTGTTTCTTGTGGG - Intergenic
1118421648 14:65612173-65612195 TTACCTTGTTTGTTACTAGAAGG + Intronic
1118810344 14:69268618-69268640 TTACCTGGTTTGTTATTTCCAGG - Intronic
1118835099 14:69472203-69472225 TTCCCTGGGTTGCTGCTTGAAGG - Intergenic
1119450419 14:74704851-74704873 TCTCCTGGTTTTTTTCTAGAGGG + Intronic
1119489282 14:75016756-75016778 TTGCTTGGTTTGTTATTTGAAGG - Exonic
1119831846 14:77710229-77710251 GTACTTGGTTTGGGTCTTGAAGG + Intronic
1121057228 14:90867578-90867600 TTTCCTGGTGTATTTCTTGTGGG - Exonic
1121482226 14:94288012-94288034 TTGCCTGTTTTGTTTGCTGATGG + Intronic
1122337032 14:100998784-100998806 TAATCTGTTTTTTTTCTTGATGG - Intergenic
1122999537 14:105285635-105285657 TTACCTATTTAGTCTCTTGATGG - Intronic
1126214949 15:46144019-46144041 TTTCCTAGCCTGTTTCTTGAGGG + Intergenic
1126288686 15:47046196-47046218 TTCCTAGCTTTGTTTCTTGAAGG - Intergenic
1126312472 15:47333680-47333702 TTGTCTGTTTTGTTTCCTGATGG - Intronic
1127597021 15:60495491-60495513 TTTTCTGACTTGTTTCTTGAGGG - Intronic
1130272191 15:82457852-82457874 TTCCCTGGTCTGTCTCTTGCTGG + Intergenic
1130393735 15:83482964-83482986 TTTCCAGGTTGGATTCTTGATGG - Intronic
1130464544 15:84185205-84185227 TTCCCTGGTCTGTCTCTTGCTGG + Intergenic
1130488143 15:84409599-84409621 TTCCCTGGTCTGTCTCTTGCTGG - Intergenic
1130499723 15:84488332-84488354 TTCCCTGGTCTGTCTCTTGCTGG - Intergenic
1130586836 15:85189819-85189841 TTCCCTGGTCTGTCTCTTGCTGG + Intergenic
1131696075 15:94879579-94879601 CTAACTGCCTTGTTTCTTGAAGG - Intergenic
1132894366 16:2221156-2221178 TTTCATTGTTTGTTTTTTGAGGG - Intergenic
1135426773 16:22344319-22344341 TTAGCTTGTCTGGTTCTTGAGGG - Intergenic
1135516383 16:23139080-23139102 CAACCTGATTTGTTTCTTAATGG + Intronic
1136750448 16:32630802-32630824 TTCTCTGGTTTGTTTCATGTTGG + Intergenic
1137397986 16:48130445-48130467 TTACCTAGTTTGTTCTTTAATGG - Intronic
1138236622 16:55388992-55389014 TTACCTGGTCAGTTGCTTGTGGG + Intergenic
1140438350 16:74967159-74967181 TTACTTGTGATGTTTCTTGAGGG - Intronic
1141441663 16:84033324-84033346 TTACCTTGTGTATTTCTGGAAGG + Exonic
1143689423 17:8548769-8548791 TTAGCTGATTTGCTTCTTGAAGG - Exonic
1145850371 17:28088187-28088209 TTTGCTTGTTTGTTTTTTGATGG + Intronic
1146082454 17:29793116-29793138 TTACCAGGCCTGTTTCTTGTGGG + Intronic
1149047431 17:52264222-52264244 TTTTCTTGTTTGTTTCTTGCTGG - Intergenic
1149953320 17:61015883-61015905 TTACCCGGTTCGTTTGGTGATGG - Exonic
1149963574 17:61139291-61139313 TTTCCTGATTTGCTTCTTTAAGG + Intronic
1150341436 17:64371238-64371260 TTACCTGTTCTGTTTCTTTATGG - Intronic
1151529984 17:74698087-74698109 TTTCCTGGATTGACTCTTGATGG - Intronic
1152533154 17:80932401-80932423 TTCTCTGCTTTGTCTCTTGATGG - Intronic
1153037155 18:774335-774357 TTACCAGGTTTGTATCTTTACGG + Intronic
1153508668 18:5829910-5829932 TTACCTGTTATGTTTCCAGAAGG + Intergenic
1153586541 18:6626755-6626777 TTACATGGTGCTTTTCTTGATGG - Intergenic
1154413126 18:14153363-14153385 TTATTTTGTTTGTTTCTTAAAGG - Intergenic
1157927938 18:51786801-51786823 TTTCCTGTTTTTTTTCTTTATGG - Intergenic
1159633466 18:70777709-70777731 TTACTTGCTTTCTCTCTTGAGGG + Intergenic
1160608066 18:80067027-80067049 TTACCTGGGTGCTTTCTTCAAGG - Intronic
1165198405 19:34125200-34125222 TTCCCTGGATTGATTGTTGAGGG - Intergenic
1165429155 19:35762338-35762360 TCACCTGCTTTATTTCCTGAAGG - Exonic
1168451987 19:56473878-56473900 TAACCTGGTTCCTTTCTTCAGGG - Intronic
927193402 2:20532208-20532230 TTTCCTGGGATGTTTGTTGAAGG - Intergenic
927580279 2:24237648-24237670 TTTCCAGATTTGTGTCTTGAGGG - Intronic
928899762 2:36304345-36304367 TTTCCATGTTTGTTTCTTGAAGG - Intergenic
931066053 2:58588464-58588486 TTACTTGGTCTATCTCTTGAAGG + Intergenic
933147163 2:78868221-78868243 TTCCCTGGTAAGTTTCTTCATGG - Intergenic
938753406 2:134357046-134357068 TTAGCTGCTTTGTTTATTGCTGG + Intronic
940144873 2:150535327-150535349 TTACCTGGTTTGTTGGTAGTAGG - Intronic
940830545 2:158460097-158460119 TTACCTGTATTGTTTTTGGAGGG + Intronic
940833747 2:158497354-158497376 TTGCCTGGTTTTTATCTTCAAGG + Intronic
941399125 2:165008826-165008848 CAACCTGGTTGGTTACTTGATGG - Intergenic
942444735 2:176070555-176070577 TTTTGGGGTTTGTTTCTTGATGG + Intergenic
942683344 2:178503613-178503635 TTTCCTTGTTTGTTTCATGCAGG - Intronic
943377472 2:187097453-187097475 TTACCTGATTTATTTTTTGTAGG + Intergenic
947060009 2:226153700-226153722 TTTCCTGTTTAGTTTATTGAGGG + Intergenic
947201277 2:227616790-227616812 TTCCCTGGTTAGTTTCTCCATGG - Intronic
948013547 2:234669764-234669786 TTTCCTGGTTTGCCTCTTGGTGG - Intergenic
948408343 2:237739875-237739897 TTACCTGATGTGATGCTTGAAGG + Intronic
948605121 2:239130101-239130123 TTGCCTGGTTTGCTTCTCAATGG - Intronic
1169198460 20:3695793-3695815 TTTCCTGGTTTATTTGTTTAGGG + Intronic
1169776806 20:9264122-9264144 CTACCTGGTGAGTTTCTTGAGGG - Intronic
1169866356 20:10204167-10204189 TTGCCTTGTTTGTTTCTTTCTGG - Intergenic
1169891640 20:10459723-10459745 GTCCCTTGTTTGTTCCTTGATGG + Intronic
1170075503 20:12414635-12414657 TTACCATGTTTGGTTCTTGCCGG + Intergenic
1171099908 20:22373387-22373409 TTCCCTTGTTTATTTCTTGAAGG - Intergenic
1174742039 20:53024307-53024329 TTTCCTGGTTTGTGTTTTAAGGG + Intronic
1176859883 21:14004892-14004914 TTATTTTGTTTGTTTCTTAAAGG + Intergenic
1177708878 21:24744831-24744853 ATACCTGTTTTATTTTTTGAAGG - Intergenic
1178037757 21:28603702-28603724 TTTCCTGGGTTGTTTTCTGAAGG + Intergenic
1178099156 21:29247626-29247648 TTTCCTGTGTTATTTCTTGATGG - Intronic
1179086905 21:38226177-38226199 ATACCTGGTTTGTTTGGTGGGGG + Intronic
1179678872 21:43003668-43003690 TTGCCTGGTTTGTGTCAGGAAGG + Intronic
1180631502 22:17233276-17233298 TTACCTGGTCTTCCTCTTGATGG - Intergenic
1181485326 22:23227281-23227303 TTAGCAGGGTTGTTTCTAGACGG - Intronic
1182388744 22:29971620-29971642 TTCCCTGTTTTGTCTCTTTAAGG + Intronic
1183427602 22:37747722-37747744 TTACCAGATTTGATCCTTGAAGG + Intronic
1184266830 22:43351982-43352004 GTTTCTGGTTTGTTTCTTGCTGG - Intergenic
950799633 3:15539623-15539645 GTACCTGGTTTTTCTCATGAGGG - Intergenic
950874445 3:16257350-16257372 TCACCTGGTTTGTTTCCTTGGGG + Intergenic
950940991 3:16891200-16891222 TTCCCTGGTTCCTTTCTTTATGG + Intronic
955076392 3:55617552-55617574 TTTCCTGGCTTGTTTATTGGTGG - Intronic
957551148 3:81706435-81706457 TTTCCTAGTTTGTTTCTTACTGG - Intronic
958006660 3:87820741-87820763 TTACCAGTTTTCTTTCTTAATGG + Intergenic
958991286 3:100848797-100848819 TTACCAGGTTTGGTTCTTGGCGG + Exonic
959714546 3:109417989-109418011 TTACCTACTTTTTTTCTGGAGGG + Intergenic
960352768 3:116613044-116613066 CTACCTGTATTGTTTCTTGTAGG - Intronic
961943830 3:130664882-130664904 TTAGTTGGTATTTTTCTTGATGG + Intronic
962006060 3:131351319-131351341 TAGGCTGGATTGTTTCTTGAAGG - Intergenic
962038623 3:131682138-131682160 TTATTTAGTTTGTTTGTTGAGGG + Intronic
963794264 3:149616056-149616078 ATTCCTGGTTTGTTTTATGAAGG - Intronic
963948772 3:151175621-151175643 TTACCTTCTTTATTTGTTGAGGG + Intronic
964177877 3:153847225-153847247 TTAACTGATTTGCTTCATGAAGG + Intergenic
964228172 3:154431176-154431198 ATACCTGCTGTGTTTATTGAAGG - Intergenic
964332594 3:155620591-155620613 TTACTTTGGTTCTTTCTTGATGG - Intronic
965016208 3:163160800-163160822 ATACCTAGTTTCTATCTTGATGG - Intergenic
965780045 3:172275817-172275839 TTATCTGGTTTTTTTTTTAAAGG + Intronic
965868648 3:173238358-173238380 CTAACTTGTTTGTGTCTTGAAGG + Intergenic
966528675 3:180948784-180948806 TTAGCTGTGTTGTTTCTGGATGG - Exonic
967849975 3:194074548-194074570 TTATCTGTTTGTTTTCTTGATGG - Intergenic
968315999 3:197726170-197726192 TTACATAGCTTGTTTCCTGAAGG + Intronic
969647190 4:8438468-8438490 ATACCTAGTTTGTTTGGTGAGGG - Intronic
970005244 4:11404665-11404687 TTACCTGGTTTGTTTCTTGAGGG - Intronic
970725137 4:19034912-19034934 TGGCCTGGTTTGTCTCTTGGTGG + Intergenic
971543722 4:27857205-27857227 TTATCTGTTTTGTTTTTTGATGG + Intergenic
971736745 4:30462989-30463011 TTAGATGGTTTGTTTATTAAAGG + Intergenic
971936763 4:33159958-33159980 CTACCTGGTTTGTTTTTTTGAGG - Intergenic
971965019 4:33542655-33542677 ATACCTGGTTTCTTTCTTCATGG - Intergenic
972009189 4:34154093-34154115 TTACATGGTTTTTTTTTTGTGGG + Intergenic
973710877 4:53629347-53629369 AAACCTGGTCTGTTTCTTGGTGG - Intronic
973714450 4:53661423-53661445 TTACCTGTTCTGTTACTTGTTGG + Intronic
973843917 4:54891684-54891706 TTACCTTGTTTGCTTCTCCATGG - Intergenic
975861990 4:78687353-78687375 TTGACTGGTTTGATTCTTGATGG - Intergenic
976756965 4:88509016-88509038 TTAGCTTGTTCTTTTCTTGAAGG + Intergenic
977353129 4:95913812-95913834 TTACTTCGTTTTTTTCATGACGG - Intergenic
977734685 4:100399400-100399422 TTTCCTGGTTTGGTTGGTGAAGG + Intronic
977879960 4:102192706-102192728 TTACCTTGAGTGTTTGTTGAAGG + Intergenic
977987819 4:103405154-103405176 TTACCTTGTTGCTTTTTTGAAGG + Intergenic
978090887 4:104713202-104713224 TGACCTTGTTTGGTTCTTGGAGG + Intergenic
978237566 4:106477988-106478010 TTTGCTTGTTTGTTTTTTGAAGG + Intergenic
978639159 4:110848391-110848413 TTTCCTGGTTTGTTTTTTCAAGG - Intergenic
978898510 4:113920433-113920455 TTGACTGGTATGTTTCTTTAGGG - Intronic
979263560 4:118675260-118675282 TTACCTGGATTCTTTCTCTAGGG - Intergenic
979945982 4:126831330-126831352 TTATTTGTTTTGTTTGTTGAGGG - Intergenic
980868807 4:138586446-138586468 TTTTCTGTTTTGTTCCTTGATGG - Intergenic
981989494 4:150900398-150900420 TTACCTGGTTTGGTTTTATAAGG - Intronic
982022389 4:151215828-151215850 TTACCTTTTTTTTTTTTTGACGG + Intronic
982079629 4:151776491-151776513 TCACCTGGTTTTTTTCTTCTTGG + Intergenic
983044210 4:162966816-162966838 TTCACTGATTTTTTTCTTGAAGG + Intergenic
983348329 4:166555673-166555695 GTAACTGCTTTGTTTCTTGTGGG - Intergenic
984884287 4:184436400-184436422 TTAACTTATTTGTTCCTTGAGGG - Intronic
984982518 4:185296484-185296506 TTATTTGATTTTTTTCTTGATGG + Intronic
985331531 4:188842094-188842116 TTTGATGGTTTCTTTCTTGAAGG - Intergenic
986602966 5:9492110-9492132 TTATCTGATTTGTTTGTTGATGG - Intronic
987460224 5:18199570-18199592 TTACCTGTCTTCTTTCTTCATGG - Intergenic
992512989 5:77458799-77458821 GTACCTGGTATGTTTTTTGTAGG - Intronic
992515286 5:77485526-77485548 TAACCTTGTCTGTTTCCTGAAGG + Intronic
993099341 5:83518005-83518027 TAGCCTGTTTTGTTTTTTGAGGG + Intronic
993622189 5:90181479-90181501 TTAGATCGTTTCTTTCTTGAGGG - Intergenic
995002027 5:107144814-107144836 TTGGCTGGTTTGTTTCTTCATGG - Intergenic
995021893 5:107376531-107376553 TTATTTGGTCTTTTTCTTGATGG + Intergenic
995204911 5:109468756-109468778 TCACCTGGTTTTTTTCTCAAGGG - Intergenic
996119893 5:119659472-119659494 TTACCTCTGTTGTTTGTTGAGGG - Intergenic
998611635 5:143695464-143695486 CTACCTGCTTTGATTCTTCATGG + Intergenic
998682411 5:144484192-144484214 TTACCCTGTTTTTTTCTTTAAGG + Exonic
998952819 5:147409047-147409069 TGACCTGGTATGATTCTTGAAGG - Intronic
999206724 5:149853727-149853749 TTCCCAACTTTGTTTCTTGAGGG + Exonic
999886716 5:155932298-155932320 CTTCCTGAATTGTTTCTTGAGGG + Intronic
1000965097 5:167647000-167647022 CTACCTTGTTTATTTCTTGTAGG + Intronic
1001059012 5:168472327-168472349 TTCCCGGCTTTGTTTCCTGAAGG - Intergenic
1002757391 6:174946-174968 TTATCTGGTTTGTTTAATGTTGG + Intergenic
1004212022 6:13657910-13657932 TGTCTTGGTTTGTTTCTTTAAGG + Intronic
1008272896 6:49510369-49510391 TTACCTGGTTTGTTCCCTGAAGG - Intronic
1008328389 6:50215203-50215225 TTACCCTGTTTGTTTCTACAGGG - Intergenic
1008876187 6:56331142-56331164 TTATTTGGTTTTTTTCTTGTTGG + Intronic
1011473642 6:87732015-87732037 TTCCCTGCTATGTTTCTTCAGGG - Intergenic
1011586397 6:88930922-88930944 TTACTTGGATGGTTTCTTTATGG - Intronic
1012026655 6:94002847-94002869 TTAGTTGGTTGCTTTCTTGAAGG - Intergenic
1012102155 6:95103985-95104007 TAACATTGTTCGTTTCTTGATGG - Intergenic
1012543178 6:100386473-100386495 TTACTTGGTTTAGATCTTGAGGG + Exonic
1014415508 6:121178389-121178411 TTACCTGATTTGTATTTTAATGG + Intronic
1014996072 6:128146350-128146372 TTACCTAATTTGTTGCTTGTTGG + Intronic
1015230041 6:130904001-130904023 CTACCTTGTTTGGTTCTGGAGGG + Intronic
1015687307 6:135879293-135879315 TTCCCTTGTTTGTTTGTAGAGGG - Intronic
1016025161 6:139279412-139279434 TTTCCTGGATTTTTTGTTGAAGG - Intronic
1017360864 6:153569270-153569292 TTTGCTTTTTTGTTTCTTGATGG - Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1020481082 7:8661926-8661948 TTAATTGGTTTGTTTTTTGGGGG - Intronic
1021934645 7:25617828-25617850 TTAACTGGTTTGCTTCTTCCTGG + Intergenic
1022097079 7:27147820-27147842 CGAACTGGTTTGTTTCTGGATGG + Intronic
1024638559 7:51310626-51310648 TTACCTGGTTTATCTTTGGAGGG + Intronic
1027566673 7:79802859-79802881 TTACTTGTTTTGTTTCTAGCTGG + Intergenic
1027771108 7:82407437-82407459 TTAATTGATTTTTTTCTTGATGG + Intronic
1028873662 7:95796311-95796333 TTTCCTTCTTTCTTTCTTGACGG + Intronic
1030602363 7:111607114-111607136 TGACTTTGTTTGTTTCTTGCTGG - Intergenic
1031597388 7:123663464-123663486 TTCCCTGGTTTTCTTCTTAAGGG - Intronic
1031682501 7:124691831-124691853 TGACATTGTTGGTTTCTTGAGGG - Intergenic
1032505901 7:132434482-132434504 CAAACTGGTTTGTGTCTTGAGGG - Intronic
1033393243 7:140949063-140949085 TTACATTTTTTGTTTCTTTATGG - Intergenic
1035049290 7:155989423-155989445 TTCCATGGTTTGTCTCTTTAAGG + Intergenic
1035099574 7:156385070-156385092 TTACCTGGCTTGTTCCTACAGGG - Intergenic
1036733827 8:11289479-11289501 ATACCTGGTTTTTTTTTTAATGG + Intronic
1038469150 8:27797327-27797349 TTACCTTCTTTGTCTCTTGATGG + Intronic
1039314623 8:36357396-36357418 TTAAGGGGTTTGTTTCTAGATGG + Intergenic
1041323574 8:56639628-56639650 TTTTCTGGTTTGGTTCATGAGGG - Intergenic
1042924495 8:73953316-73953338 TTAGGTGGTTTGTTTGGTGATGG - Intronic
1044765270 8:95565739-95565761 TTACCTTATTTGTTTTTTGAGGG + Intergenic
1045274951 8:100695328-100695350 TCCACTGGTTTGTTTCTTCAAGG + Intronic
1047646538 8:126876139-126876161 TTACCTGGCTTATTTCTTTATGG - Intergenic
1050434545 9:5594930-5594952 TTCCCTGGGTTATTTCTGGAAGG + Intergenic
1050818222 9:9842621-9842643 TTAACTGGTATGTTACTTAAAGG - Intronic
1051852629 9:21527600-21527622 TCTACTGGTTTGTTTCTGGAAGG + Intergenic
1052129600 9:24826754-24826776 TTAACTGTCTAGTTTCTTGAAGG - Intergenic
1053724496 9:40985094-40985116 TTAACTCGTTTGTTTAATGAGGG - Intergenic
1055868346 9:80843324-80843346 TTGTTTGTTTTGTTTCTTGAAGG - Intergenic
1058053046 9:100425699-100425721 TGCCCTGGATTGTTTTTTGAGGG + Intergenic
1058528276 9:105881780-105881802 TCAGTTGGTTGGTTTCTTGAGGG - Intergenic
1060257314 9:122043684-122043706 TTACCTATTTTGTTTTTTGTTGG - Intronic
1060475130 9:123981066-123981088 GTACCTGGATTCTTTTTTGAAGG + Intergenic
1062016801 9:134295133-134295155 TTACCCTGGTTGTTTCTTCAAGG - Intergenic
1062475717 9:136726031-136726053 TTACCTGGTTTGCTCCATGAGGG - Intergenic
1186783262 X:12934689-12934711 TTACATGGTTTGTTTACTGATGG + Intergenic
1189054087 X:37680234-37680256 TTACCAGGTTTATTTATGGAGGG - Intronic
1190228393 X:48562925-48562947 TTAACTGGTGTGTGTTTTGACGG + Intergenic
1195743448 X:108090478-108090500 TTACCTGGTTTACTTCATTATGG - Intronic
1196257868 X:113543911-113543933 TTACCTGCTTTGTGTCTTTAAGG + Intergenic
1197048190 X:122025986-122026008 TTATCTGCTTTGATGCTTGATGG - Intergenic
1197111204 X:122777264-122777286 TTATTTGTTTTGTTTTTTGAGGG + Intergenic
1197144097 X:123152056-123152078 TTATCTATTTTGTTTTTTGAAGG - Intergenic
1197531698 X:127636512-127636534 TTACATGGATTGTCTCTTGAAGG - Intergenic
1199030996 X:143000074-143000096 TTACCCATTTTGTTTCTTTAAGG - Intergenic
1199840860 X:151646891-151646913 CTACCTGGTTAATTTCTTCAAGG - Intronic
1202370679 Y:24193468-24193490 TTCCCTGGTCTGTCTCTTGCTGG - Intergenic
1202500105 Y:25476649-25476671 TTCCCTGGTCTGTCTCTTGCTGG + Intergenic