ID: 970005666

View in Genome Browser
Species Human (GRCh38)
Location 4:11408570-11408592
Sequence GGTGAGGCAGGCCCCAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970005660_970005666 12 Left 970005660 4:11408535-11408557 CCTGAACGAATGATGAGCAGCCA 0: 1
1: 0
2: 1
3: 2
4: 74
Right 970005666 4:11408570-11408592 GGTGAGGCAGGCCCCAGTGAAGG 0: 1
1: 0
2: 1
3: 33
4: 361
970005664_970005666 -8 Left 970005664 4:11408555-11408577 CCAGGTGTGTGCAGTGGTGAGGC 0: 1
1: 0
2: 2
3: 35
4: 292
Right 970005666 4:11408570-11408592 GGTGAGGCAGGCCCCAGTGAAGG 0: 1
1: 0
2: 1
3: 33
4: 361
970005659_970005666 27 Left 970005659 4:11408520-11408542 CCTTCATAAAGGGCTCCTGAACG No data
Right 970005666 4:11408570-11408592 GGTGAGGCAGGCCCCAGTGAAGG 0: 1
1: 0
2: 1
3: 33
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970005666 Original CRISPR GGTGAGGCAGGCCCCAGTGA AGG Intronic