ID: 970007789

View in Genome Browser
Species Human (GRCh38)
Location 4:11427789-11427811
Sequence CCAAAGCCGGGTGCCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970007789_970007799 16 Left 970007789 4:11427789-11427811 CCCGCGCCGGCACCCGGCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 970007799 4:11427828-11427850 CCATCATCCGCCTACGTTCTGGG 0: 1
1: 0
2: 1
3: 1
4: 28
970007789_970007797 15 Left 970007789 4:11427789-11427811 CCCGCGCCGGCACCCGGCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 970007797 4:11427827-11427849 CCCATCATCCGCCTACGTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970007789 Original CRISPR CCAAAGCCGGGTGCCGGCGC GGG (reversed) Intronic
900586369 1:3434142-3434164 CCACTGCCGGGTGCCCGCGTGGG + Exonic
905066936 1:35192382-35192404 CCGAAGCCAGGTGGCGGCCCGGG - Exonic
909447006 1:75758889-75758911 CCAAAGCAGGTTGCCGCTGCAGG - Intronic
914097426 1:144555691-144555713 TCAGAGACTGGTGCCGGCGCGGG - Intergenic
914301567 1:146381927-146381949 TCAGAGACTGGTGCCGGCGCGGG + Intergenic
915519924 1:156436187-156436209 CCCGAGCCGGGTGCCGGCGGCGG - Intergenic
924667030 1:246083495-246083517 TCAGAGGCTGGTGCCGGCGCGGG + Intronic
924800890 1:247329263-247329285 CCAGAGCTGGGTGCGGGCGCAGG - Exonic
1067713010 10:48665360-48665382 CCAAAGGCGGTTGCCGTTGCTGG + Intergenic
1069677361 10:70258057-70258079 TCAGAGACCGGTGCCGGCGCAGG + Intronic
1070146029 10:73773763-73773785 CCAAAGCCAGGTGTGGGCACTGG - Exonic
1070676032 10:78411902-78411924 CCACAGCCGAGTGCCAGGGCAGG + Intergenic
1075589642 10:123682049-123682071 CCAAAGACTGGGGCAGGCGCTGG + Intronic
1076817061 10:132920252-132920274 CCAATGCCCTGCGCCGGCGCCGG + Intronic
1076871302 10:133196322-133196344 CCCATGCCGGGTGCGGGTGCAGG - Intronic
1077271322 11:1683428-1683450 CCAAATCCCAGTGCCGGAGCGGG + Intergenic
1077342893 11:2033832-2033854 TCACAGCCTGGTGCCGGCGTGGG + Intergenic
1078594338 11:12674159-12674181 ACAAAGCCCGGAGCCCGCGCCGG + Intergenic
1081014574 11:37859739-37859761 TCAGAGACCGGTGCCGGCGCGGG + Intergenic
1082724558 11:56719520-56719542 TCAAAGACCGGTGCCGGTGCAGG + Intergenic
1083728884 11:64642749-64642771 CCAGGGCCGGGGGGCGGCGCGGG + Intronic
1083894594 11:65613753-65613775 CCATGGCCGGGAGCCGGCGCTGG + Exonic
1084437765 11:69154352-69154374 CCAAAGCCTGGTCCCCGCCCAGG - Intergenic
1088032274 11:105265656-105265678 TCAGAGACCGGTGCCGGCGCTGG + Intergenic
1088764381 11:112962001-112962023 CCAAAGGCGGGCGGCGGGGCGGG + Intronic
1091201191 11:133782400-133782422 CCAGTTCCGGGTGCCGGCCCTGG + Intergenic
1202825879 11_KI270721v1_random:89021-89043 TCACAGCCTGGTGCCGGCGTGGG + Intergenic
1092455153 12:8636469-8636491 TCAGAGACCGGTGCCGGCGCCGG + Intergenic
1092645862 12:10571408-10571430 TCAGAGACCGGTGCCGGCGCTGG - Intergenic
1098654310 12:73008864-73008886 TCAGAGACTGGTGCCGGCGCGGG - Intergenic
1100385594 12:94102155-94102177 CCAGAGCCGGGAGCTTGCGCAGG - Intergenic
1105612131 13:21977822-21977844 CCACAGCCTGGTGGCGGAGCGGG - Intergenic
1105688665 13:22813789-22813811 TCAAAGACTGGTGCTGGCGCGGG - Intergenic
1108362198 13:49678028-49678050 CCCAAGCCGGTTGCCGGGGCTGG + Intronic
1114802470 14:25792906-25792928 TCAGAGACTGGTGCCGGCGCGGG - Intergenic
1118288996 14:64503779-64503801 CCATCGCGGGCTGCCGGCGCGGG - Exonic
1123088942 14:105733269-105733291 CCAGAGACCGGTGCCGGTGCAGG + Intergenic
1124399164 15:29333507-29333529 CCAAAGCCGGGTGCCCGGGAGGG - Intronic
1129608162 15:77034889-77034911 CCTAAGCCTGGTGCAGGGGCAGG + Intronic
1131866451 15:96716303-96716325 ACAATGCCGGGTGGCGGCTCAGG - Intergenic
1132381315 15:101368617-101368639 CCAGAGCTGGGTGCAGGCCCAGG - Intronic
1132502523 16:290856-290878 TCCAAGCCGGGTGGAGGCGCAGG + Intronic
1132925942 16:2429237-2429259 CCAATGGCGGGTCCCGGAGCAGG + Intergenic
1133040052 16:3055972-3055994 GCAAGGCCGGGTGCTGGGGCCGG + Intronic
1133298409 16:4766940-4766962 ACAGACCCGGGTGCTGGCGCGGG + Intronic
1136283946 16:29230515-29230537 CCAAAGCCGGGGGTGGGAGCGGG - Intergenic
1137540323 16:49357227-49357249 CCAAAGCCCCCTGCCGGGGCCGG + Intergenic
1138344898 16:56314651-56314673 CAGAAGCCAGGCGCCGGCGCTGG - Intronic
1138493859 16:57394980-57395002 CCCAAGCAGGTTGCCGCCGCTGG + Intergenic
1139385478 16:66566391-66566413 CGAGAGCCGGGTGCACGCGCCGG + Intronic
1142088978 16:88200025-88200047 CCAAAGCCGGGGGTGGGAGCGGG - Intergenic
1142596313 17:1031631-1031653 CCAGAGCCGGGCGCCGGTGTTGG + Intronic
1143635709 17:8162821-8162843 CCAAGGGCGGCGGCCGGCGCAGG + Intronic
1145839805 17:27984892-27984914 CCACAGCTGGGTGCCTGCGCTGG + Intergenic
1146229298 17:31094647-31094669 CCAAACCCGGAGGCCGGCGGGGG + Intergenic
1147818624 17:43228506-43228528 CCAAAGCCATCTGCCGGCGCCGG + Intergenic
1147831907 17:43303208-43303230 CCAAAGCCATCTGCCGGCGCCGG + Intergenic
1148553510 17:48564432-48564454 ACAAAGCCGGGGGCGGGGGCGGG - Intronic
1148936236 17:51166413-51166435 CCACACCCGGGAGCCGGCGGCGG - Intronic
1149491020 17:57085331-57085353 GCACAGCCGGGGGCCGGCGGCGG + Intronic
1150003264 17:61455038-61455060 CCCGAGGCGGGTGCTGGCGCTGG + Intronic
1152652096 17:81499514-81499536 ACAAATCCGGGTGCCGACCCGGG + Intergenic
1155570255 18:27185041-27185063 CCAGAGCCCGCTCCCGGCGCGGG + Intronic
1155942275 18:31811306-31811328 TCAGAGACCGGTGCCGGCGCGGG + Intergenic
1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG + Intronic
1159045623 18:63366827-63366849 GCGAGGCCGGGTGCCGGGGCCGG + Intronic
1159606511 18:70479984-70480006 TCAAAGGCTGGTGCCGGTGCAGG + Intergenic
1160706194 19:531410-531432 CCAAAGCCGGGGGACCGGGCCGG + Intergenic
1161096245 19:2393142-2393164 CCCAAGCCGGTTGCCGCTGCTGG - Intronic
1161304153 19:3557599-3557621 CCAGAGCCGGGCGACTGCGCCGG + Intronic
1161745495 19:6057082-6057104 CCAAAGGCTGGTGCCGGCCAAGG - Intronic
1163279498 19:16306939-16306961 CCAGAGCCGGGTGCTGACTCTGG - Intergenic
1165463797 19:35960068-35960090 CCAAAGGCTGGTCCCGGCTCAGG + Intergenic
1167818661 19:51906500-51906522 TCAGAGACCGGTGCCGGCGCGGG + Intronic
1168317893 19:55491960-55491982 GCAAAGCTGGGTGCCTGCCCAGG + Intronic
926108315 2:10166287-10166309 CCAGAGCCGGCTGCAGGGGCAGG + Intronic
930021760 2:47005939-47005961 GCTGAGCCGGGTGCCGGAGCAGG + Exonic
935064585 2:99636729-99636751 CCACAGCCGGGAGCCAGCACAGG + Intronic
936278179 2:111118135-111118157 CCACAGCCGGGTGCCGCCAAAGG + Exonic
1172020071 20:31907939-31907961 CCAAATCTGGGTGCCAGAGCTGG - Intronic
1175573422 20:60041318-60041340 TCAGAGACTGGTGCCGGCGCAGG - Intergenic
1176447383 21:6831690-6831712 CCAGATCCGGGTGGCTGCGCTGG + Intergenic
1176825551 21:13696716-13696738 CCAGATCCGGGTGGCTGCGCTGG + Intergenic
1179675113 21:42975321-42975343 CCTCAGCCGGGCGCCGGCGCGGG + Intronic
1180699720 22:17774566-17774588 CCACAGCCCCGCGCCGGCGCGGG - Intronic
1181981080 22:26767021-26767043 CCCAAGCTGGTTGCCGGTGCGGG - Intergenic
1183664178 22:39237894-39237916 CCAAAGCCGGGTGCCTAGCCAGG + Intronic
960080169 3:113532930-113532952 CCAAAGCCCGGTGCAGGGCCAGG - Exonic
966743376 3:183254022-183254044 CCAATGCCGGGAGCCCGCGCTGG - Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
970007789 4:11427789-11427811 CCAAAGCCGGGTGCCGGCGCGGG - Intronic
971720012 4:30233025-30233047 TCAGAGCCCGGTGCCGGTGCAGG - Intergenic
977536653 4:98261727-98261749 CGCACGCCGGGTGCCGGGGCTGG + Intronic
984801835 4:183723084-183723106 CCCAAGGCGGGTGCTGGCGGCGG - Intergenic
990400162 5:55429734-55429756 CCACAGCTGGGTGCTGCCGCAGG + Intronic
992459379 5:76945787-76945809 CCAGAGACCGGTGCCGGTGCTGG + Intergenic
996534073 5:124558013-124558035 CCCAAGCCGGTTGCCGCTGCTGG + Intergenic
1001653227 5:173329682-173329704 CCAACGCCGGGTGCGTGCCCTGG - Intergenic
1002277481 5:178113473-178113495 CCACATCCGGGGGCCGGGGCCGG + Exonic
1002526755 5:179819515-179819537 CCATAGCCGGGGGCTGGGGCAGG + Intronic
1005293341 6:24400187-24400209 TCAGAGGCCGGTGCCGGCGCGGG - Intergenic
1006230760 6:32584456-32584478 CCTGAGCGGGGTGCGGGCGCTGG + Intronic
1013192519 6:107815666-107815688 CCAGAGGCGGGTGCCTGCGTTGG + Intronic
1013259445 6:108426667-108426689 CCAAAGACTGGTGCTGGTGCTGG - Intronic
1017801312 6:157898810-157898832 CCAAAGCAGGGTGCAGGTCCCGG + Intronic
1018858594 6:167693690-167693712 CCAGAGCCGGTTGCCGCTGCTGG - Intergenic
1019355806 7:578213-578235 CCCATTCCGGGTGCCGGCGAGGG - Intronic
1019774062 7:2901859-2901881 CCACAGCAGGCTGGCGGCGCTGG - Intergenic
1019989667 7:4682605-4682627 GCAGAGCCCGGGGCCGGCGCTGG + Exonic
1024313319 7:47990476-47990498 TCAGAGACTGGTGCCGGCGCGGG + Intronic
1029746380 7:102517707-102517729 CCATCGCGGGGTGCCGGCTCGGG + Exonic
1029894741 7:103971001-103971023 CAAAAGCCGGGTGTGGTCGCGGG + Intronic
1034470479 7:151251951-151251973 CCCAGGCCGGGGACCGGCGCGGG - Intronic
1038540143 8:28385236-28385258 CCAAAACCGGGAGGCGGCGGCGG + Intronic
1039582853 8:38681201-38681223 CCATAGCCGGGTGAGGGAGCTGG - Intergenic
1045114949 8:98972467-98972489 CCTAAGCCATGAGCCGGCGCCGG - Intergenic
1047942300 8:129837313-129837335 CCAAAGACGGGTTCCGCCTCAGG - Intergenic
1054452589 9:65411206-65411228 CCAGAGCAGGGTGCCAGCGAGGG - Intergenic
1061191395 9:129084806-129084828 CCAAAGCAGGGTGGGGGCACTGG - Intronic
1062478961 9:136742743-136742765 CCTGAGCCGGGCGCCGGCTCTGG - Intronic
1203521807 Un_GL000213v1:52841-52863 CCAGATCCGGGTGGCTGCGCTGG - Intergenic
1185444684 X:251312-251334 TCAGAGGCAGGTGCCGGCGCGGG - Intergenic
1185551763 X:987642-987664 TCAGAGGCCGGTGCCGGCGCCGG - Intergenic
1198215587 X:134551143-134551165 CCAGAACCGCGTGCGGGCGCTGG + Intergenic
1198696261 X:139342055-139342077 TCAGAGGCCGGTGCCGGCGCGGG - Intergenic
1199368784 X:147020748-147020770 CCAAAGGGGGGTGCCGTTGCTGG - Intergenic