ID: 970008074

View in Genome Browser
Species Human (GRCh38)
Location 4:11429041-11429063
Sequence TGGGCGGCACCCGAGCGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970008074_970008079 -6 Left 970008074 4:11429041-11429063 CCGGCCCGCTCGGGTGCCGCCCA 0: 1
1: 0
2: 0
3: 13
4: 102
Right 970008079 4:11429058-11429080 CGCCCAGAGTCCGGCCCGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 75
970008074_970008082 1 Left 970008074 4:11429041-11429063 CCGGCCCGCTCGGGTGCCGCCCA 0: 1
1: 0
2: 0
3: 13
4: 102
Right 970008082 4:11429065-11429087 AGTCCGGCCCGCTAGGTGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970008074 Original CRISPR TGGGCGGCACCCGAGCGGGC CGG (reversed) Exonic
900109879 1:1000851-1000873 TGCGCGTGACGCGAGCGGGCTGG + Intergenic
900372398 1:2337781-2337803 AGGTCGGCACCAGAGCTGGCTGG + Intronic
905202447 1:36323530-36323552 GCGGCGGGACCCGAGCGGGCGGG - Intronic
905308457 1:37034299-37034321 TGGGCGGCAGCCAGGCGGGGCGG - Intergenic
905692728 1:39955087-39955109 TTGGCCGCAACCGAGAGGGCTGG + Intergenic
915462185 1:156076821-156076843 TCCGCGGGACCCGAGCTGGCCGG - Exonic
920665985 1:207963423-207963445 TGGGCGGCCTCCCAGCCGGCCGG + Intergenic
922951117 1:229558915-229558937 GGGAGGGCACCCGAGCGGGTTGG - Intergenic
923141118 1:231162309-231162331 TCGGCGGGACCCGACCGGCCCGG - Intronic
924436451 1:244048270-244048292 TGGGCGGGGCTCGGGCGGGCGGG - Intergenic
924823687 1:247518430-247518452 AGGGCGGCAGCCGCGCGGGAAGG - Intronic
1063385953 10:5616456-5616478 TGGGCGGCACTCGGGGGGGTGGG - Intergenic
1063385970 10:5616493-5616515 TGGGCGGCACTCGGGGGGGTGGG - Intergenic
1063385979 10:5616512-5616534 TGGGCGGCACTCGGGGGGGTGGG - Intergenic
1065114979 10:22476393-22476415 GGGGATGCGCCCGAGCGGGCTGG - Intergenic
1067416467 10:46106625-46106647 TGGGCGGCCCCGGCGCGGGAGGG - Intergenic
1067436598 10:46283104-46283126 TGGGCGGCCCCCGCGCGGGAGGG - Intergenic
1074130373 10:110568134-110568156 TGGGTGGCCCCAGAGCTGGCGGG + Intronic
1078067939 11:8090137-8090159 TGGGCGGCCCCGGAGCCGGCGGG + Exonic
1083595721 11:63917511-63917533 TGGGCTCCACCCGGGCGGGCGGG - Intergenic
1087855951 11:103091993-103092015 TGGGCCGCGCCGGTGCGGGCTGG - Exonic
1087936156 11:104036764-104036786 TGGGCGGCTCACTGGCGGGCTGG - Exonic
1088764618 11:112963059-112963081 TGGGAGGGACCCGAGTTGGCTGG - Intronic
1088916244 11:114230055-114230077 TGGGCTTCAACCGAGAGGGCGGG - Intronic
1090653202 11:128824552-128824574 TGGGGGGCAGCCGAGGGCGCGGG + Intergenic
1096461070 12:51821672-51821694 TGGGCGGTGCCGGCGCGGGCAGG + Intergenic
1102539710 12:113610001-113610023 TGGGCGGAGGCCGAGGGGGCTGG + Intergenic
1103778568 12:123384222-123384244 TGGCCGGCACCGGAGCGGCTGGG + Intronic
1122238833 14:100348439-100348461 TGGGGGGCACTGGAGAGGGCGGG + Intronic
1124831537 15:33154050-33154072 TCGGAGGCCGCCGAGCGGGCTGG - Exonic
1130517035 15:84633572-84633594 GTGGCGGCAGCCGAGGGGGCCGG + Intergenic
1132522227 16:397129-397151 CGGGGGGCTCCCGGGCGGGCGGG + Intronic
1132888008 16:2190902-2190924 TGGGAGGCAGGCGAGTGGGCTGG + Intronic
1133058402 16:3158791-3158813 TGGCCGGGACCCGGGCGGGGAGG + Intergenic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1139433808 16:66925144-66925166 GCGGCGGCAGCGGAGCGGGCGGG - Exonic
1142495219 17:302636-302658 TGGGTGGCAGCCGGGAGGGCCGG - Intronic
1143637801 17:8176389-8176411 TGGGCGGTGCCTGAGCGGGCGGG - Exonic
1145279445 17:21457131-21457153 TGGGCGGGACCGGGCCGGGCAGG - Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1150643486 17:66964678-66964700 TGCGCGGCCGCCGGGCGGGCTGG - Intergenic
1152313152 17:79563045-79563067 TGCGCAGCAGCAGAGCGGGCGGG + Intergenic
1160453307 18:78979662-78979684 GGCGCGGCGCCCGAGCGGCCCGG + Intergenic
1160889698 19:1370773-1370795 CGGGCGGCCCGCGAGCGGTCGGG - Exonic
1161069093 19:2251591-2251613 CGGGCGGGATCCGCGCGGGCCGG + Exonic
1161424963 19:4198330-4198352 GGGGCGGCACCAGGGAGGGCGGG + Intronic
1165058593 19:33194351-33194373 CCGGCGGCACCCGGCCGGGCGGG + Intronic
1165065383 19:33225529-33225551 TGAGCGGGACCCAGGCGGGCGGG - Intronic
1166310412 19:41959224-41959246 TGAGCGGCACGTGAGCGAGCTGG - Exonic
1166679466 19:44758132-44758154 GGGGCGGCACCGGATCGGGGTGG - Intronic
1167053838 19:47096375-47096397 TGGGCCGCACCCCAGCGGGAAGG - Intronic
1167463896 19:49640143-49640165 CGGGCGGGACCCGGGGGGGCGGG + Exonic
1168277078 19:55284328-55284350 TGGGGGGCAGCCGGGGGGGCCGG + Exonic
925926879 2:8677117-8677139 TGGGCCGCCCGCGAGCTGGCGGG - Intergenic
929075644 2:38076884-38076906 GGGGCGGGACCCGAGCGGGGCGG + Intronic
931665911 2:64609453-64609475 TGGGGCGCCCCCGAGCGGGCGGG - Intergenic
932313922 2:70767479-70767501 AGGGCGGCGGCCGAGCGGGAAGG + Intronic
934754610 2:96816509-96816531 TGGGTGGCCCCGGAGGGGGCGGG + Exonic
935147519 2:100405925-100405947 TGGGCGGTGCCGGAGCAGGCAGG + Intronic
937933065 2:127220212-127220234 CGGCCGGCGCCCGAGCGGGGTGG - Intergenic
947846922 2:233251944-233251966 TGAGCGGCGCCGGTGCGGGCTGG + Intronic
948115816 2:235493962-235493984 AGGGCGGCAAGCGCGCGGGCAGG + Intergenic
948150369 2:235739882-235739904 TGGGCGGCAGTGGAGCTGGCAGG + Intronic
948479134 2:238239559-238239581 TGGCCTGCACCTGCGCGGGCGGG + Exonic
1168948530 20:1780961-1780983 TGGGAGGCACCCGAGTAGGGGGG - Intergenic
1169093120 20:2873383-2873405 AGGGCGGGGCCCGCGCGGGCCGG + Intronic
1169195824 20:3681618-3681640 TGGGCTGCCCCCGAGGGGGAGGG + Intronic
1172429253 20:34876486-34876508 TGGGCGGTGCCAGAGGGGGCGGG - Intronic
1175358667 20:58389695-58389717 TGGCCGGGACCCGAGAGGGCTGG + Intronic
1175997152 20:62817010-62817032 CGGGCGGCGCGCGGGCGGGCGGG - Intronic
1176194416 20:63830855-63830877 TGGGGGGCACCCGCGGGGGCCGG + Intronic
1178544287 21:33480049-33480071 GGGGCGGGACGCGAGGGGGCGGG + Intergenic
1182268662 22:29138794-29138816 TGGGCGCCACCCATGGGGGCTGG + Exonic
1183720387 22:39558572-39558594 TGGCTGGCACCCCAGCGGGGCGG + Intergenic
1183739605 22:39662503-39662525 GAGGCGGGGCCCGAGCGGGCGGG + Intronic
1184222625 22:43110676-43110698 GGGGCGGGACCCGGGCGGGGCGG + Intergenic
1184465784 22:44668475-44668497 TGGGCGGCGCCCGCCGGGGCAGG - Intergenic
950553694 3:13682632-13682654 GGGGCAGCAGCCGAGGGGGCTGG - Intergenic
950583501 3:13878191-13878213 AGGGCGGCCCGCGGGCGGGCGGG + Intronic
953037796 3:39227849-39227871 TGGGTGGCAGCCGGGCGGGAGGG - Intergenic
953627291 3:44581225-44581247 TGGGCGGCGGCGGTGCGGGCGGG - Intronic
962714599 3:138115533-138115555 TTGGCGGCACTGGAGTGGGCCGG - Exonic
965590481 3:170357135-170357157 TGCGCGGCGTCCGAGCGGCCAGG + Intergenic
968080567 3:195843592-195843614 CGGGCTGCACCCGAGCAGGGTGG + Intergenic
968506434 4:973337-973359 GGGCCGGGACCCGAGCGGGCGGG - Exonic
968814058 4:2812662-2812684 TGAGAGGCCCCCGAGCTGGCAGG + Intronic
968814099 4:2812768-2812790 TGGGCCCCACCCCAGCAGGCTGG - Intronic
970008074 4:11429041-11429063 TGGGCGGCACCCGAGCGGGCCGG - Exonic
985717940 5:1473130-1473152 TGGGTGGAACCCGGGCTGGCAGG - Intronic
986150043 5:5120190-5120212 TGGGTGGCACCCAAGCAGGAGGG - Intergenic
989102335 5:37834813-37834835 GCGGCGGCACCTGCGCGGGCAGG + Exonic
997304054 5:132825621-132825643 TGGGCCGCAGACGGGCGGGCAGG + Exonic
998292396 5:140927523-140927545 TGTGCGTCTCCTGAGCGGGCAGG - Exonic
998295765 5:140967469-140967491 TGTGCCGTACCCGAGCGGGCTGG - Exonic
1019111955 6:169724060-169724082 GGGCCGGCCCCCGGGCGGGCGGG - Intronic
1020080352 7:5283171-5283193 GGGGCAGCGCCCGGGCGGGCGGG - Intronic
1026850379 7:73719753-73719775 TGGGCGGGGCCCGGGCGGGGTGG - Intergenic
1027059418 7:75073680-75073702 GGGGCGGCGGCTGAGCGGGCCGG - Exonic
1028417597 7:90596416-90596438 TGGGCCGCAGCTGGGCGGGCGGG - Intronic
1035244554 7:157553928-157553950 AGGAGGGCACCAGAGCGGGCAGG - Intronic
1035244588 7:157554038-157554060 AGGAGGGCACGCGAGCGGGCAGG - Intronic
1035468903 7:159097417-159097439 TGGTGGGCACGCGAGGGGGCCGG - Intronic
1037881407 8:22575148-22575170 TGGGAGGAACCCCAGCAGGCGGG - Exonic
1042784851 8:72536508-72536530 GGGACGGCCCCCGAGCGAGCGGG + Intergenic
1047616144 8:126564052-126564074 AGGGAGGCACCCGAGCAGGGTGG - Intergenic
1049405941 8:142451911-142451933 TCGGCGGCACCCCGGCGTGCGGG - Intronic
1049864071 8:144922298-144922320 TTGGCAGCACCAGAGTGGGCAGG + Intergenic
1049891396 9:73522-73544 CGGGCGGTCCCCGGGCGGGCGGG - Intergenic
1056135136 9:83623390-83623412 TGGGCGCCCCGCGAGCAGGCTGG - Intronic
1056475172 9:86946294-86946316 CGGGCGGCCCCGGCGCGGGCGGG - Exonic
1057258229 9:93567861-93567883 TGGGTGGCACTGGTGCGGGCTGG + Intergenic
1061489822 9:130938737-130938759 GGGGCGGCCCGGGAGCGGGCGGG + Exonic
1061652507 9:132062300-132062322 TGGGCAACACGGGAGCGGGCAGG + Intronic
1192584042 X:72306380-72306402 TGGGCGGCCGCCAGGCGGGCCGG - Intronic
1198228542 X:134668923-134668945 TGGGTGGCAACAGAGCAGGCAGG + Intronic
1199976610 X:152898147-152898169 TGGACGGCGCCCGGCCGGGCCGG - Intergenic