ID: 970008839

View in Genome Browser
Species Human (GRCh38)
Location 4:11436454-11436476
Sequence TTCAGTGTGTACTCTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970008839_970008841 19 Left 970008839 4:11436454-11436476 CCTGACACAGAGTACACACTGAA No data
Right 970008841 4:11436496-11436518 CAAAAAGGAATTAAATCAGATGG No data
970008839_970008840 4 Left 970008839 4:11436454-11436476 CCTGACACAGAGTACACACTGAA No data
Right 970008840 4:11436481-11436503 TGTGTGCTGTTATTACAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970008839 Original CRISPR TTCAGTGTGTACTCTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr