ID: 970010574

View in Genome Browser
Species Human (GRCh38)
Location 4:11454576-11454598
Sequence GTGTATCAGAAGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970010571_970010574 28 Left 970010571 4:11454525-11454547 CCAGCTTGAGCAACAGAGCAAGC No data
Right 970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970010574 Original CRISPR GTGTATCAGAAGAAGGAGGC TGG Intergenic
No off target data available for this crispr