ID: 970010851

View in Genome Browser
Species Human (GRCh38)
Location 4:11457489-11457511
Sequence AGATGCAAAAAGTGTCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970010850_970010851 -1 Left 970010850 4:11457467-11457489 CCTCTGTGTGTAGTATGGAAGGA No data
Right 970010851 4:11457489-11457511 AGATGCAAAAAGTGTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970010851 Original CRISPR AGATGCAAAAAGTGTCTGAA AGG Intergenic
No off target data available for this crispr