ID: 970012132

View in Genome Browser
Species Human (GRCh38)
Location 4:11470817-11470839
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012132_970012140 17 Left 970012132 4:11470817-11470839 CCTGGCTGTGGCTAGTCACCATG No data
Right 970012140 4:11470857-11470879 TTCTCACCACCAGATCAGCCAGG No data
970012132_970012141 18 Left 970012132 4:11470817-11470839 CCTGGCTGTGGCTAGTCACCATG No data
Right 970012141 4:11470858-11470880 TCTCACCACCAGATCAGCCAGGG No data
970012132_970012143 23 Left 970012132 4:11470817-11470839 CCTGGCTGTGGCTAGTCACCATG No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012132 Original CRISPR CATGGTGACTAGCCACAGCC AGG (reversed) Intergenic