ID: 970012133

View in Genome Browser
Species Human (GRCh38)
Location 4:11470835-11470857
Sequence AGAATTTGGGGGTGGCGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012133_970012146 23 Left 970012133 4:11470835-11470857 CCATGCCGCCACCCCCAAATTCT No data
Right 970012146 4:11470881-11470903 AACGGCTTGCTGAAACCTGCTGG No data
970012133_970012141 0 Left 970012133 4:11470835-11470857 CCATGCCGCCACCCCCAAATTCT No data
Right 970012141 4:11470858-11470880 TCTCACCACCAGATCAGCCAGGG No data
970012133_970012140 -1 Left 970012133 4:11470835-11470857 CCATGCCGCCACCCCCAAATTCT No data
Right 970012140 4:11470857-11470879 TTCTCACCACCAGATCAGCCAGG No data
970012133_970012143 5 Left 970012133 4:11470835-11470857 CCATGCCGCCACCCCCAAATTCT No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012133 Original CRISPR AGAATTTGGGGGTGGCGGCA TGG (reversed) Intergenic