ID: 970012134

View in Genome Browser
Species Human (GRCh38)
Location 4:11470840-11470862
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012134_970012146 18 Left 970012134 4:11470840-11470862 CCGCCACCCCCAAATTCTTCTCA No data
Right 970012146 4:11470881-11470903 AACGGCTTGCTGAAACCTGCTGG No data
970012134_970012140 -6 Left 970012134 4:11470840-11470862 CCGCCACCCCCAAATTCTTCTCA No data
Right 970012140 4:11470857-11470879 TTCTCACCACCAGATCAGCCAGG No data
970012134_970012141 -5 Left 970012134 4:11470840-11470862 CCGCCACCCCCAAATTCTTCTCA No data
Right 970012141 4:11470858-11470880 TCTCACCACCAGATCAGCCAGGG No data
970012134_970012143 0 Left 970012134 4:11470840-11470862 CCGCCACCCCCAAATTCTTCTCA No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012134 Original CRISPR TGAGAAGAATTTGGGGGTGG CGG (reversed) Intergenic
No off target data available for this crispr