ID: 970012137

View in Genome Browser
Species Human (GRCh38)
Location 4:11470847-11470869
Sequence CTGGTGGTGAGAAGAATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012137_970012148 29 Left 970012137 4:11470847-11470869 CCCCAAATTCTTCTCACCACCAG No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data
970012137_970012143 -7 Left 970012137 4:11470847-11470869 CCCCAAATTCTTCTCACCACCAG No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
970012137_970012146 11 Left 970012137 4:11470847-11470869 CCCCAAATTCTTCTCACCACCAG No data
Right 970012146 4:11470881-11470903 AACGGCTTGCTGAAACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012137 Original CRISPR CTGGTGGTGAGAAGAATTTG GGG (reversed) Intergenic