ID: 970012138

View in Genome Browser
Species Human (GRCh38)
Location 4:11470848-11470870
Sequence TCTGGTGGTGAGAAGAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012138_970012143 -8 Left 970012138 4:11470848-11470870 CCCAAATTCTTCTCACCACCAGA No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
970012138_970012148 28 Left 970012138 4:11470848-11470870 CCCAAATTCTTCTCACCACCAGA No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data
970012138_970012146 10 Left 970012138 4:11470848-11470870 CCCAAATTCTTCTCACCACCAGA No data
Right 970012146 4:11470881-11470903 AACGGCTTGCTGAAACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012138 Original CRISPR TCTGGTGGTGAGAAGAATTT GGG (reversed) Intergenic
No off target data available for this crispr