ID: 970012140

View in Genome Browser
Species Human (GRCh38)
Location 4:11470857-11470879
Sequence TTCTCACCACCAGATCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012131_970012140 18 Left 970012131 4:11470816-11470838 CCCTGGCTGTGGCTAGTCACCAT No data
Right 970012140 4:11470857-11470879 TTCTCACCACCAGATCAGCCAGG No data
970012134_970012140 -6 Left 970012134 4:11470840-11470862 CCGCCACCCCCAAATTCTTCTCA No data
Right 970012140 4:11470857-11470879 TTCTCACCACCAGATCAGCCAGG No data
970012133_970012140 -1 Left 970012133 4:11470835-11470857 CCATGCCGCCACCCCCAAATTCT No data
Right 970012140 4:11470857-11470879 TTCTCACCACCAGATCAGCCAGG No data
970012135_970012140 -9 Left 970012135 4:11470843-11470865 CCACCCCCAAATTCTTCTCACCA No data
Right 970012140 4:11470857-11470879 TTCTCACCACCAGATCAGCCAGG No data
970012132_970012140 17 Left 970012132 4:11470817-11470839 CCTGGCTGTGGCTAGTCACCATG No data
Right 970012140 4:11470857-11470879 TTCTCACCACCAGATCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012140 Original CRISPR TTCTCACCACCAGATCAGCC AGG Intergenic