ID: 970012141

View in Genome Browser
Species Human (GRCh38)
Location 4:11470858-11470880
Sequence TCTCACCACCAGATCAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012133_970012141 0 Left 970012133 4:11470835-11470857 CCATGCCGCCACCCCCAAATTCT No data
Right 970012141 4:11470858-11470880 TCTCACCACCAGATCAGCCAGGG No data
970012135_970012141 -8 Left 970012135 4:11470843-11470865 CCACCCCCAAATTCTTCTCACCA No data
Right 970012141 4:11470858-11470880 TCTCACCACCAGATCAGCCAGGG No data
970012132_970012141 18 Left 970012132 4:11470817-11470839 CCTGGCTGTGGCTAGTCACCATG No data
Right 970012141 4:11470858-11470880 TCTCACCACCAGATCAGCCAGGG No data
970012134_970012141 -5 Left 970012134 4:11470840-11470862 CCGCCACCCCCAAATTCTTCTCA No data
Right 970012141 4:11470858-11470880 TCTCACCACCAGATCAGCCAGGG No data
970012131_970012141 19 Left 970012131 4:11470816-11470838 CCCTGGCTGTGGCTAGTCACCAT No data
Right 970012141 4:11470858-11470880 TCTCACCACCAGATCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012141 Original CRISPR TCTCACCACCAGATCAGCCA GGG Intergenic
No off target data available for this crispr