ID: 970012142

View in Genome Browser
Species Human (GRCh38)
Location 4:11470863-11470885
Sequence CCGTTCCCTGGCTGATCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012142_970012146 -5 Left 970012142 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
Right 970012146 4:11470881-11470903 AACGGCTTGCTGAAACCTGCTGG No data
970012142_970012149 17 Left 970012142 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
Right 970012149 4:11470903-11470925 GCTCTTTCTTGTGACCTGGAAGG No data
970012142_970012148 13 Left 970012142 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data
970012142_970012150 29 Left 970012142 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
Right 970012150 4:11470915-11470937 GACCTGGAAGGATGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012142 Original CRISPR CCGTTCCCTGGCTGATCTGG TGG (reversed) Intergenic
No off target data available for this crispr