ID: 970012143

View in Genome Browser
Species Human (GRCh38)
Location 4:11470863-11470885
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012138_970012143 -8 Left 970012138 4:11470848-11470870 CCCAAATTCTTCTCACCACCAGA No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
970012139_970012143 -9 Left 970012139 4:11470849-11470871 CCAAATTCTTCTCACCACCAGAT No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
970012134_970012143 0 Left 970012134 4:11470840-11470862 CCGCCACCCCCAAATTCTTCTCA No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
970012137_970012143 -7 Left 970012137 4:11470847-11470869 CCCCAAATTCTTCTCACCACCAG No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
970012136_970012143 -6 Left 970012136 4:11470846-11470868 CCCCCAAATTCTTCTCACCACCA No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
970012131_970012143 24 Left 970012131 4:11470816-11470838 CCCTGGCTGTGGCTAGTCACCAT No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
970012133_970012143 5 Left 970012133 4:11470835-11470857 CCATGCCGCCACCCCCAAATTCT No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
970012135_970012143 -3 Left 970012135 4:11470843-11470865 CCACCCCCAAATTCTTCTCACCA No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
970012132_970012143 23 Left 970012132 4:11470817-11470839 CCTGGCTGTGGCTAGTCACCATG No data
Right 970012143 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr