ID: 970012144

View in Genome Browser
Species Human (GRCh38)
Location 4:11470866-11470888
Sequence AAGCCGTTCCCTGGCTGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012144_970012149 14 Left 970012144 4:11470866-11470888 CCAGATCAGCCAGGGAACGGCTT No data
Right 970012149 4:11470903-11470925 GCTCTTTCTTGTGACCTGGAAGG No data
970012144_970012148 10 Left 970012144 4:11470866-11470888 CCAGATCAGCCAGGGAACGGCTT No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data
970012144_970012146 -8 Left 970012144 4:11470866-11470888 CCAGATCAGCCAGGGAACGGCTT No data
Right 970012146 4:11470881-11470903 AACGGCTTGCTGAAACCTGCTGG No data
970012144_970012150 26 Left 970012144 4:11470866-11470888 CCAGATCAGCCAGGGAACGGCTT No data
Right 970012150 4:11470915-11470937 GACCTGGAAGGATGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012144 Original CRISPR AAGCCGTTCCCTGGCTGATC TGG (reversed) Intergenic
No off target data available for this crispr