ID: 970012145

View in Genome Browser
Species Human (GRCh38)
Location 4:11470875-11470897
Sequence GGTTTCAGCAAGCCGTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012145_970012149 5 Left 970012145 4:11470875-11470897 CCAGGGAACGGCTTGCTGAAACC No data
Right 970012149 4:11470903-11470925 GCTCTTTCTTGTGACCTGGAAGG No data
970012145_970012150 17 Left 970012145 4:11470875-11470897 CCAGGGAACGGCTTGCTGAAACC No data
Right 970012150 4:11470915-11470937 GACCTGGAAGGATGACAGAGAGG No data
970012145_970012152 29 Left 970012145 4:11470875-11470897 CCAGGGAACGGCTTGCTGAAACC No data
Right 970012152 4:11470927-11470949 TGACAGAGAGGCTGACATCCTGG No data
970012145_970012148 1 Left 970012145 4:11470875-11470897 CCAGGGAACGGCTTGCTGAAACC No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012145 Original CRISPR GGTTTCAGCAAGCCGTTCCC TGG (reversed) Intergenic