ID: 970012148

View in Genome Browser
Species Human (GRCh38)
Location 4:11470899-11470921
Sequence GCTGGCTCTTTCTTGTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012136_970012148 30 Left 970012136 4:11470846-11470868 CCCCCAAATTCTTCTCACCACCA No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data
970012142_970012148 13 Left 970012142 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data
970012137_970012148 29 Left 970012137 4:11470847-11470869 CCCCAAATTCTTCTCACCACCAG No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data
970012145_970012148 1 Left 970012145 4:11470875-11470897 CCAGGGAACGGCTTGCTGAAACC No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data
970012144_970012148 10 Left 970012144 4:11470866-11470888 CCAGATCAGCCAGGGAACGGCTT No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data
970012138_970012148 28 Left 970012138 4:11470848-11470870 CCCAAATTCTTCTCACCACCAGA No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data
970012139_970012148 27 Left 970012139 4:11470849-11470871 CCAAATTCTTCTCACCACCAGAT No data
Right 970012148 4:11470899-11470921 GCTGGCTCTTTCTTGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012148 Original CRISPR GCTGGCTCTTTCTTGTGACC TGG Intergenic
No off target data available for this crispr