ID: 970012149

View in Genome Browser
Species Human (GRCh38)
Location 4:11470903-11470925
Sequence GCTCTTTCTTGTGACCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012142_970012149 17 Left 970012142 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
Right 970012149 4:11470903-11470925 GCTCTTTCTTGTGACCTGGAAGG No data
970012144_970012149 14 Left 970012144 4:11470866-11470888 CCAGATCAGCCAGGGAACGGCTT No data
Right 970012149 4:11470903-11470925 GCTCTTTCTTGTGACCTGGAAGG No data
970012145_970012149 5 Left 970012145 4:11470875-11470897 CCAGGGAACGGCTTGCTGAAACC No data
Right 970012149 4:11470903-11470925 GCTCTTTCTTGTGACCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012149 Original CRISPR GCTCTTTCTTGTGACCTGGA AGG Intergenic
No off target data available for this crispr