ID: 970012150

View in Genome Browser
Species Human (GRCh38)
Location 4:11470915-11470937
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012147_970012150 -4 Left 970012147 4:11470896-11470918 CCTGCTGGCTCTTTCTTGTGACC No data
Right 970012150 4:11470915-11470937 GACCTGGAAGGATGACAGAGAGG No data
970012144_970012150 26 Left 970012144 4:11470866-11470888 CCAGATCAGCCAGGGAACGGCTT No data
Right 970012150 4:11470915-11470937 GACCTGGAAGGATGACAGAGAGG No data
970012145_970012150 17 Left 970012145 4:11470875-11470897 CCAGGGAACGGCTTGCTGAAACC No data
Right 970012150 4:11470915-11470937 GACCTGGAAGGATGACAGAGAGG No data
970012142_970012150 29 Left 970012142 4:11470863-11470885 CCACCAGATCAGCCAGGGAACGG No data
Right 970012150 4:11470915-11470937 GACCTGGAAGGATGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr