ID: 970012152 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:11470927-11470949 |
Sequence | TGACAGAGAGGCTGACATCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
970012147_970012152 | 8 | Left | 970012147 | 4:11470896-11470918 | CCTGCTGGCTCTTTCTTGTGACC | No data | ||
Right | 970012152 | 4:11470927-11470949 | TGACAGAGAGGCTGACATCCTGG | No data | ||||
970012145_970012152 | 29 | Left | 970012145 | 4:11470875-11470897 | CCAGGGAACGGCTTGCTGAAACC | No data | ||
Right | 970012152 | 4:11470927-11470949 | TGACAGAGAGGCTGACATCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
970012152 | Original CRISPR | TGACAGAGAGGCTGACATCC TGG | Intergenic | ||