ID: 970012152

View in Genome Browser
Species Human (GRCh38)
Location 4:11470927-11470949
Sequence TGACAGAGAGGCTGACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970012147_970012152 8 Left 970012147 4:11470896-11470918 CCTGCTGGCTCTTTCTTGTGACC No data
Right 970012152 4:11470927-11470949 TGACAGAGAGGCTGACATCCTGG No data
970012145_970012152 29 Left 970012145 4:11470875-11470897 CCAGGGAACGGCTTGCTGAAACC No data
Right 970012152 4:11470927-11470949 TGACAGAGAGGCTGACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970012152 Original CRISPR TGACAGAGAGGCTGACATCC TGG Intergenic