ID: 970016734

View in Genome Browser
Species Human (GRCh38)
Location 4:11520465-11520487
Sequence ACCTTGCTAGAGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970016734_970016737 3 Left 970016734 4:11520465-11520487 CCTGCTTCCCTCTCTAGCAAGGT No data
Right 970016737 4:11520491-11520513 TTTTTGTCTTTCCTTACTCTTGG No data
970016734_970016738 10 Left 970016734 4:11520465-11520487 CCTGCTTCCCTCTCTAGCAAGGT No data
Right 970016738 4:11520498-11520520 CTTTCCTTACTCTTGGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970016734 Original CRISPR ACCTTGCTAGAGAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr