ID: 970017629

View in Genome Browser
Species Human (GRCh38)
Location 4:11530615-11530637
Sequence CACTCCCTCCGGAGGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970017622_970017629 27 Left 970017622 4:11530565-11530587 CCAGAAGAAATACAAAATCATTG No data
Right 970017629 4:11530615-11530637 CACTCCCTCCGGAGGCTCTAGGG No data
970017625_970017629 1 Left 970017625 4:11530591-11530613 CCAAGTCAAGATGTTAGCAGGCT No data
Right 970017629 4:11530615-11530637 CACTCCCTCCGGAGGCTCTAGGG No data
970017624_970017629 2 Left 970017624 4:11530590-11530612 CCCAAGTCAAGATGTTAGCAGGC No data
Right 970017629 4:11530615-11530637 CACTCCCTCCGGAGGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970017629 Original CRISPR CACTCCCTCCGGAGGCTCTA GGG Intergenic
No off target data available for this crispr