ID: 970018065

View in Genome Browser
Species Human (GRCh38)
Location 4:11534906-11534928
Sequence CGATTCTAAGGTCAGCCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970018065_970018072 16 Left 970018065 4:11534906-11534928 CCAACTGGCTGACCTTAGAATCG No data
Right 970018072 4:11534945-11534967 TATTGGAGCACACTCAGTAGTGG No data
970018065_970018074 18 Left 970018065 4:11534906-11534928 CCAACTGGCTGACCTTAGAATCG No data
Right 970018074 4:11534947-11534969 TTGGAGCACACTCAGTAGTGGGG No data
970018065_970018070 -1 Left 970018065 4:11534906-11534928 CCAACTGGCTGACCTTAGAATCG No data
Right 970018070 4:11534928-11534950 GGGAGATTATCCTGGATTATTGG No data
970018065_970018069 -9 Left 970018065 4:11534906-11534928 CCAACTGGCTGACCTTAGAATCG No data
Right 970018069 4:11534920-11534942 TTAGAATCGGGAGATTATCCTGG No data
970018065_970018073 17 Left 970018065 4:11534906-11534928 CCAACTGGCTGACCTTAGAATCG No data
Right 970018073 4:11534946-11534968 ATTGGAGCACACTCAGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970018065 Original CRISPR CGATTCTAAGGTCAGCCAGT TGG (reversed) Intergenic
No off target data available for this crispr