ID: 970032521

View in Genome Browser
Species Human (GRCh38)
Location 4:11692818-11692840
Sequence AGTCCCAGTGGATCACCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970032515_970032521 13 Left 970032515 4:11692782-11692804 CCGTGTATAAATGATCCACCTAT No data
Right 970032521 4:11692818-11692840 AGTCCCAGTGGATCACCTGCTGG No data
970032518_970032521 -5 Left 970032518 4:11692800-11692822 CCTATTAGCTCCAGCTGGAGTCC No data
Right 970032521 4:11692818-11692840 AGTCCCAGTGGATCACCTGCTGG No data
970032517_970032521 -2 Left 970032517 4:11692797-11692819 CCACCTATTAGCTCCAGCTGGAG No data
Right 970032521 4:11692818-11692840 AGTCCCAGTGGATCACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970032521 Original CRISPR AGTCCCAGTGGATCACCTGC TGG Intergenic
No off target data available for this crispr