ID: 970034778

View in Genome Browser
Species Human (GRCh38)
Location 4:11720840-11720862
Sequence TCCATGAGATCCCACCTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970034777_970034778 -3 Left 970034777 4:11720820-11720842 CCAATAAAGACAAAATTATATCC No data
Right 970034778 4:11720840-11720862 TCCATGAGATCCCACCTAATAGG No data
970034776_970034778 15 Left 970034776 4:11720802-11720824 CCAATAAAGTAAGCATTTCCAAT No data
Right 970034778 4:11720840-11720862 TCCATGAGATCCCACCTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970034778 Original CRISPR TCCATGAGATCCCACCTAAT AGG Intergenic
No off target data available for this crispr