ID: 970044064

View in Genome Browser
Species Human (GRCh38)
Location 4:11830093-11830115
Sequence ATGGAGCAGAAGAAAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970044059_970044064 -3 Left 970044059 4:11830073-11830095 CCAATCAGTTGAAGCCCTGAATG No data
Right 970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG No data
970044055_970044064 20 Left 970044055 4:11830050-11830072 CCCTCAATGTGAGCAGACCTCAC No data
Right 970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG No data
970044057_970044064 3 Left 970044057 4:11830067-11830089 CCTCACCCAATCAGTTGAAGCCC No data
Right 970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG No data
970044054_970044064 21 Left 970044054 4:11830049-11830071 CCCCTCAATGTGAGCAGACCTCA No data
Right 970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG No data
970044058_970044064 -2 Left 970044058 4:11830072-11830094 CCCAATCAGTTGAAGCCCTGAAT No data
Right 970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG No data
970044056_970044064 19 Left 970044056 4:11830051-11830073 CCTCAATGTGAGCAGACCTCACC No data
Right 970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970044064 Original CRISPR ATGGAGCAGAAGAAAAAGGA AGG Intergenic
No off target data available for this crispr