ID: 970044282

View in Genome Browser
Species Human (GRCh38)
Location 4:11832657-11832679
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970044276_970044282 21 Left 970044276 4:11832613-11832635 CCTTCTACATTATTTTTTAATTC No data
Right 970044282 4:11832657-11832679 AAATTAGGAGAGCAGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr