ID: 970044447

View in Genome Browser
Species Human (GRCh38)
Location 4:11835133-11835155
Sequence GGTAAACTGAGACCTAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970044437_970044447 22 Left 970044437 4:11835088-11835110 CCCTTGGTTAGGGTACTCAGGGA No data
Right 970044447 4:11835133-11835155 GGTAAACTGAGACCTAAATCAGG No data
970044445_970044447 -5 Left 970044445 4:11835115-11835137 CCCTCTGGGGTATGGATAGGTAA No data
Right 970044447 4:11835133-11835155 GGTAAACTGAGACCTAAATCAGG No data
970044446_970044447 -6 Left 970044446 4:11835116-11835138 CCTCTGGGGTATGGATAGGTAAA No data
Right 970044447 4:11835133-11835155 GGTAAACTGAGACCTAAATCAGG No data
970044438_970044447 21 Left 970044438 4:11835089-11835111 CCTTGGTTAGGGTACTCAGGGAA No data
Right 970044447 4:11835133-11835155 GGTAAACTGAGACCTAAATCAGG No data
970044444_970044447 -4 Left 970044444 4:11835114-11835136 CCCCTCTGGGGTATGGATAGGTA No data
Right 970044447 4:11835133-11835155 GGTAAACTGAGACCTAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970044447 Original CRISPR GGTAAACTGAGACCTAAATC AGG Intergenic
No off target data available for this crispr