ID: 970052551

View in Genome Browser
Species Human (GRCh38)
Location 4:11931134-11931156
Sequence AAAGTTAGAAAACCTGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970052551_970052553 27 Left 970052551 4:11931134-11931156 CCAAGAACAGGTTTTCTAACTTT No data
Right 970052553 4:11931184-11931206 CACAACCACATACATCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970052551 Original CRISPR AAAGTTAGAAAACCTGTTCT TGG (reversed) Intergenic
No off target data available for this crispr