ID: 970053540

View in Genome Browser
Species Human (GRCh38)
Location 4:11945155-11945177
Sequence GCCTTGCTGCTGCTGGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970053534_970053540 11 Left 970053534 4:11945121-11945143 CCCTCTGGAGTGAGGGTGAGCTT No data
Right 970053540 4:11945155-11945177 GCCTTGCTGCTGCTGGTCACTGG No data
970053535_970053540 10 Left 970053535 4:11945122-11945144 CCTCTGGAGTGAGGGTGAGCTTG No data
Right 970053540 4:11945155-11945177 GCCTTGCTGCTGCTGGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970053540 Original CRISPR GCCTTGCTGCTGCTGGTCAC TGG Intergenic
No off target data available for this crispr