ID: 970056959 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:11984782-11984804 |
Sequence | AGTATGCCCAAATCTTGTCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
970056959_970056963 | 19 | Left | 970056959 | 4:11984782-11984804 | CCATGACAAGATTTGGGCATACT | No data | ||
Right | 970056963 | 4:11984824-11984846 | GTTTTAATGATGTGTAGCAACGG | No data | ||||
970056959_970056964 | 22 | Left | 970056959 | 4:11984782-11984804 | CCATGACAAGATTTGGGCATACT | No data | ||
Right | 970056964 | 4:11984827-11984849 | TTAATGATGTGTAGCAACGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
970056959 | Original CRISPR | AGTATGCCCAAATCTTGTCA TGG (reversed) | Intergenic | ||