ID: 970056959

View in Genome Browser
Species Human (GRCh38)
Location 4:11984782-11984804
Sequence AGTATGCCCAAATCTTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970056959_970056963 19 Left 970056959 4:11984782-11984804 CCATGACAAGATTTGGGCATACT No data
Right 970056963 4:11984824-11984846 GTTTTAATGATGTGTAGCAACGG No data
970056959_970056964 22 Left 970056959 4:11984782-11984804 CCATGACAAGATTTGGGCATACT No data
Right 970056964 4:11984827-11984849 TTAATGATGTGTAGCAACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970056959 Original CRISPR AGTATGCCCAAATCTTGTCA TGG (reversed) Intergenic