ID: 970057088

View in Genome Browser
Species Human (GRCh38)
Location 4:11987153-11987175
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970057088_970057091 18 Left 970057088 4:11987153-11987175 CCCTCTTCACTCCAAATACAAAG No data
Right 970057091 4:11987194-11987216 AAAGTCCTAAATAAAACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970057088 Original CRISPR CTTTGTATTTGGAGTGAAGA GGG (reversed) Intergenic
No off target data available for this crispr