ID: 970061122

View in Genome Browser
Species Human (GRCh38)
Location 4:12035714-12035736
Sequence CAGCTCCAGTTTAGAACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970061122_970061127 3 Left 970061122 4:12035714-12035736 CCAGTGGTTCTAAACTGGAGCTG No data
Right 970061127 4:12035740-12035762 TTGTCCCTCAAAGGGACATTGGG No data
970061122_970061130 9 Left 970061122 4:12035714-12035736 CCAGTGGTTCTAAACTGGAGCTG No data
Right 970061130 4:12035746-12035768 CTCAAAGGGACATTGGGCAAAGG No data
970061122_970061125 -5 Left 970061122 4:12035714-12035736 CCAGTGGTTCTAAACTGGAGCTG No data
Right 970061125 4:12035732-12035754 AGCTGGTTTTGTCCCTCAAAGGG No data
970061122_970061132 29 Left 970061122 4:12035714-12035736 CCAGTGGTTCTAAACTGGAGCTG No data
Right 970061132 4:12035766-12035788 AGGACATTGTCAAAGGACATTGG No data
970061122_970061133 30 Left 970061122 4:12035714-12035736 CCAGTGGTTCTAAACTGGAGCTG No data
Right 970061133 4:12035767-12035789 GGACATTGTCAAAGGACATTGGG No data
970061122_970061131 22 Left 970061122 4:12035714-12035736 CCAGTGGTTCTAAACTGGAGCTG No data
Right 970061131 4:12035759-12035781 TGGGCAAAGGACATTGTCAAAGG No data
970061122_970061126 2 Left 970061122 4:12035714-12035736 CCAGTGGTTCTAAACTGGAGCTG No data
Right 970061126 4:12035739-12035761 TTTGTCCCTCAAAGGGACATTGG No data
970061122_970061124 -6 Left 970061122 4:12035714-12035736 CCAGTGGTTCTAAACTGGAGCTG No data
Right 970061124 4:12035731-12035753 GAGCTGGTTTTGTCCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970061122 Original CRISPR CAGCTCCAGTTTAGAACCAC TGG (reversed) Intergenic
No off target data available for this crispr