ID: 970061340

View in Genome Browser
Species Human (GRCh38)
Location 4:12037874-12037896
Sequence AAAAAACCACAGTCTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970061340_970061344 6 Left 970061340 4:12037874-12037896 CCCAGCCCAGACTGTGGTTTTTT No data
Right 970061344 4:12037903-12037925 TAACTTTAGTGTATCTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970061340 Original CRISPR AAAAAACCACAGTCTGGGCT GGG (reversed) Intergenic
No off target data available for this crispr