ID: 970079981

View in Genome Browser
Species Human (GRCh38)
Location 4:12271366-12271388
Sequence AACCACCTGATGTCAGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970079981_970079990 21 Left 970079981 4:12271366-12271388 CCCCTACCTGACATCAGGTGGTT No data
Right 970079990 4:12271410-12271432 GCATCTCTTCTTTCCCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970079981 Original CRISPR AACCACCTGATGTCAGGTAG GGG (reversed) Intergenic
No off target data available for this crispr