ID: 970079990

View in Genome Browser
Species Human (GRCh38)
Location 4:12271410-12271432
Sequence GCATCTCTTCTTTCCCTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970079981_970079990 21 Left 970079981 4:12271366-12271388 CCCCTACCTGACATCAGGTGGTT No data
Right 970079990 4:12271410-12271432 GCATCTCTTCTTTCCCTATGTGG No data
970079982_970079990 20 Left 970079982 4:12271367-12271389 CCCTACCTGACATCAGGTGGTTG No data
Right 970079990 4:12271410-12271432 GCATCTCTTCTTTCCCTATGTGG No data
970079985_970079990 15 Left 970079985 4:12271372-12271394 CCTGACATCAGGTGGTTGAGGTC No data
Right 970079990 4:12271410-12271432 GCATCTCTTCTTTCCCTATGTGG No data
970079983_970079990 19 Left 970079983 4:12271368-12271390 CCTACCTGACATCAGGTGGTTGA No data
Right 970079990 4:12271410-12271432 GCATCTCTTCTTTCCCTATGTGG No data
970079979_970079990 24 Left 970079979 4:12271363-12271385 CCTCCCCTACCTGACATCAGGTG No data
Right 970079990 4:12271410-12271432 GCATCTCTTCTTTCCCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970079990 Original CRISPR GCATCTCTTCTTTCCCTATG TGG Intergenic
No off target data available for this crispr