ID: 970095883 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:12462149-12462171 |
| Sequence | AGCGTGGATATCAGCAGCGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 970095883_970095892 | 29 | Left | 970095883 | 4:12462149-12462171 | CCACCGCTGCTGATATCCACGCT | No data | ||
| Right | 970095892 | 4:12462201-12462223 | CTCCAACAGACCTGCAGCTGAGG | No data | ||||
| 970095883_970095893 | 30 | Left | 970095883 | 4:12462149-12462171 | CCACCGCTGCTGATATCCACGCT | No data | ||
| Right | 970095893 | 4:12462202-12462224 | TCCAACAGACCTGCAGCTGAGGG | No data | ||||
| 970095883_970095889 | -6 | Left | 970095883 | 4:12462149-12462171 | CCACCGCTGCTGATATCCACGCT | No data | ||
| Right | 970095889 | 4:12462166-12462188 | CACGCTAACAGGGTCTGGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 970095883 | Original CRISPR | AGCGTGGATATCAGCAGCGG TGG (reversed) | Intergenic | ||