ID: 970095883

View in Genome Browser
Species Human (GRCh38)
Location 4:12462149-12462171
Sequence AGCGTGGATATCAGCAGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970095883_970095889 -6 Left 970095883 4:12462149-12462171 CCACCGCTGCTGATATCCACGCT No data
Right 970095889 4:12462166-12462188 CACGCTAACAGGGTCTGGAGTGG No data
970095883_970095893 30 Left 970095883 4:12462149-12462171 CCACCGCTGCTGATATCCACGCT No data
Right 970095893 4:12462202-12462224 TCCAACAGACCTGCAGCTGAGGG No data
970095883_970095892 29 Left 970095883 4:12462149-12462171 CCACCGCTGCTGATATCCACGCT No data
Right 970095892 4:12462201-12462223 CTCCAACAGACCTGCAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970095883 Original CRISPR AGCGTGGATATCAGCAGCGG TGG (reversed) Intergenic