ID: 970104976

View in Genome Browser
Species Human (GRCh38)
Location 4:12571926-12571948
Sequence TGGAATGAAAAAAAGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970104976_970104982 3 Left 970104976 4:12571926-12571948 CCTCTCCACTTTTTTTCATTCCA No data
Right 970104982 4:12571952-12571974 TGCTCACCTGCATCTTGGAGGGG No data
970104976_970104980 1 Left 970104976 4:12571926-12571948 CCTCTCCACTTTTTTTCATTCCA No data
Right 970104980 4:12571950-12571972 GCTGCTCACCTGCATCTTGGAGG No data
970104976_970104979 -2 Left 970104976 4:12571926-12571948 CCTCTCCACTTTTTTTCATTCCA No data
Right 970104979 4:12571947-12571969 CAAGCTGCTCACCTGCATCTTGG No data
970104976_970104981 2 Left 970104976 4:12571926-12571948 CCTCTCCACTTTTTTTCATTCCA No data
Right 970104981 4:12571951-12571973 CTGCTCACCTGCATCTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970104976 Original CRISPR TGGAATGAAAAAAAGTGGAG AGG (reversed) Intergenic
No off target data available for this crispr