ID: 970104981

View in Genome Browser
Species Human (GRCh38)
Location 4:12571951-12571973
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970104977_970104981 -3 Left 970104977 4:12571931-12571953 CCACTTTTTTTCATTCCAAGCTG No data
Right 970104981 4:12571951-12571973 CTGCTCACCTGCATCTTGGAGGG No data
970104976_970104981 2 Left 970104976 4:12571926-12571948 CCTCTCCACTTTTTTTCATTCCA No data
Right 970104981 4:12571951-12571973 CTGCTCACCTGCATCTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr