ID: 970104982

View in Genome Browser
Species Human (GRCh38)
Location 4:12571952-12571974
Sequence TGCTCACCTGCATCTTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970104976_970104982 3 Left 970104976 4:12571926-12571948 CCTCTCCACTTTTTTTCATTCCA No data
Right 970104982 4:12571952-12571974 TGCTCACCTGCATCTTGGAGGGG No data
970104977_970104982 -2 Left 970104977 4:12571931-12571953 CCACTTTTTTTCATTCCAAGCTG No data
Right 970104982 4:12571952-12571974 TGCTCACCTGCATCTTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970104982 Original CRISPR TGCTCACCTGCATCTTGGAG GGG Intergenic
No off target data available for this crispr