ID: 970106656

View in Genome Browser
Species Human (GRCh38)
Location 4:12593516-12593538
Sequence TGTGTTAGAAGACCTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970106656_970106659 14 Left 970106656 4:12593516-12593538 CCTGGAACAGGTCTTCTAACACA No data
Right 970106659 4:12593553-12593575 TTATCTTTACAATAGATGCTGGG No data
970106656_970106660 15 Left 970106656 4:12593516-12593538 CCTGGAACAGGTCTTCTAACACA No data
Right 970106660 4:12593554-12593576 TATCTTTACAATAGATGCTGGGG No data
970106656_970106658 13 Left 970106656 4:12593516-12593538 CCTGGAACAGGTCTTCTAACACA No data
Right 970106658 4:12593552-12593574 CTTATCTTTACAATAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970106656 Original CRISPR TGTGTTAGAAGACCTGTTCC AGG (reversed) Intergenic
No off target data available for this crispr